Incidental Mutation 'RF002:Blm'
ID 602561
Institutional Source Beutler Lab
Gene Symbol Blm
Ensembl Gene ENSMUSG00000030528
Gene Name Bloom syndrome, RecQ like helicase
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # RF002 (G1)
Quality Score 217.468
Status Not validated
Chromosome 7
Chromosomal Location 80454733-80535119 bp(-) (GRCm38)
Type of Mutation small insertion (4 aa in frame mutation)
DNA Base Change (assembly) CTC to CTCATCCTCCTCATC at 80512927 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081314] [ENSMUST00000170315]
AlphaFold O88700
Predicted Effect probably benign
Transcript: ENSMUST00000081314
SMART Domains Protein: ENSMUSP00000080062
Gene: ENSMUSG00000030528

low complexity region 46 54 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 219 231 N/A INTRINSIC
low complexity region 318 335 N/A INTRINSIC
Pfam:BDHCT 376 416 5.5e-27 PFAM
low complexity region 557 574 N/A INTRINSIC
DEXDc 672 873 1.59e-29 SMART
HELICc 910 992 1.29e-24 SMART
RQC 1084 1198 1.43e-15 SMART
HRDC 1217 1297 9.4e-20 SMART
low complexity region 1357 1371 N/A INTRINSIC
low complexity region 1378 1392 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170315
SMART Domains Protein: ENSMUSP00000127995
Gene: ENSMUSG00000030528

Pfam:BLM_N 4 375 1.1e-161 PFAM
Pfam:BDHCT 380 419 6.4e-25 PFAM
Pfam:BDHCT_assoc 433 658 8.8e-108 PFAM
DEXDc 675 876 1.59e-29 SMART
HELICc 913 995 1.29e-24 SMART
Pfam:RecQ_Zn_bind 1006 1078 1.5e-19 PFAM
RQC 1087 1201 1.43e-15 SMART
HRDC 1220 1300 9.4e-20 SMART
low complexity region 1360 1374 N/A INTRINSIC
low complexity region 1381 1395 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Bloom syndrome gene product is related to the RecQ subset of DExH box-containing DNA helicases and has both DNA-stimulated ATPase and ATP-dependent DNA helicase activities. Mutations causing Bloom syndrome delete or alter helicase motifs and may disable the 3'-5' helicase activity. The normal protein may act to suppress inappropriate recombination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are developmentally delayed, with increased apopotosis in the epiblast and severe anemia, dying at embyronic day 13.5; but homozygotes for a cre mediated recombinant allele are viable Bloom syndrome-like mice prone to a wide variety of cancers and showing increased rates of LOH. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,235 probably benign Het
Angptl1 A T 1: 156,857,224 Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 51,805,593 probably null Het
Car13 T C 3: 14,654,914 Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,712,523 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cdh26 T C 2: 178,466,631 C341R probably damaging Het
Chga GCA GCACCA 12: 102,561,421 probably benign Het
Col11a1 A T 3: 114,217,001 I1689L unknown Het
Dnah6 T G 6: 73,101,889 S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,455,186 probably benign Het
Fah A C 7: 84,589,628 N336K probably damaging Het
Fbxo11 A T 17: 87,996,053 I664K Het
Fcgbp A G 7: 28,089,755 D582G probably benign Het
Gabre C CCGGCTA X: 72,270,057 probably null Het
Gm1110 A G 9: 26,920,640 Y72H probably damaging Het
Gm14025 A G 2: 129,038,794 F404S Het
Inpp5e C T 2: 26,408,377 A71T possibly damaging Het
Iqcm C T 8: 75,577,899 T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 93,018,283 probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 93,018,299 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lyst A G 13: 13,634,363 D206G probably benign Het
Map4k5 A T 12: 69,856,856 D58E probably damaging Het
Mapkapk2 A G 1: 131,056,513 S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,652,529 probably benign Het
Men1 T C 19: 6,340,116 S600P probably damaging Het
Mllt1 C T 17: 56,896,300 V394M probably benign Het
Mllt1 C A 17: 56,896,301 M393I possibly damaging Het
Nacc1 T C 8: 84,676,219 E315G possibly damaging Het
Nid2 TAACACCGCCA TA 14: 19,751,366 probably benign Het
Olfr1484 T A 19: 13,586,051 I206N probably damaging Het
Parp2 A G 14: 50,817,386 E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,279,375 probably null Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Ppp3cc T C 14: 70,267,339 T73A possibly damaging Het
Prdm15 C T 16: 97,799,629 D810N probably damaging Het
Prpf4b T A 13: 34,884,236 S349R unknown Het
Sdk2 T C 11: 113,885,252 E208G probably benign Het
Smurf2 G T 11: 106,852,587 P211Q probably benign Het
Snx25 C A 8: 46,116,181 probably null Het
Spata6 T A 4: 111,828,305 M469K probably benign Het
Spta1 G T 1: 174,231,360 A1954S possibly damaging Het
Stard8 GAG GAGTAG X: 99,066,515 probably null Het
Tfeb AGC AGCGGC 17: 47,786,102 probably benign Het
Tlcd1 T A 11: 78,180,194 L203Q probably benign Het
Tlr11 T C 14: 50,361,225 F223L possibly damaging Het
Usp48 T A 4: 137,605,795 V100D probably damaging Het
Vmn2r56 G A 7: 12,694,830 T503I probably benign Het
Vps18 T C 2: 119,297,390 L898P probably damaging Het
Zfp706 T A 15: 37,003,705 Y39F probably benign Het
Zhx3 T A 2: 160,781,806 N147I probably damaging Het
Other mutations in Blm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Blm APN 7 80474071 missense probably damaging 1.00
IGL01658:Blm APN 7 80463941 missense probably damaging 0.98
IGL02048:Blm APN 7 80502961 splice site probably benign
IGL02060:Blm APN 7 80514580 splice site probably benign
IGL02063:Blm APN 7 80509419 nonsense probably null
IGL02102:Blm APN 7 80469756 missense probably damaging 1.00
IGL02420:Blm APN 7 80496006 missense probably damaging 1.00
IGL02452:Blm APN 7 80503377 splice site probably null
IGL02566:Blm APN 7 80474196 missense probably damaging 1.00
IGL03387:Blm APN 7 80494147 missense probably damaging 1.00
FR4304:Blm UTSW 7 80463773 frame shift probably null
FR4304:Blm UTSW 7 80512919 small insertion probably benign
FR4340:Blm UTSW 7 80463767 unclassified probably benign
FR4340:Blm UTSW 7 80512907 small insertion probably benign
FR4340:Blm UTSW 7 80512910 small insertion probably benign
FR4449:Blm UTSW 7 80512908 small insertion probably benign
FR4548:Blm UTSW 7 80463769 frame shift probably null
FR4589:Blm UTSW 7 80463770 frame shift probably null
FR4737:Blm UTSW 7 80463771 frame shift probably null
FR4737:Blm UTSW 7 80463774 frame shift probably null
FR4976:Blm UTSW 7 80463767 unclassified probably benign
FR4976:Blm UTSW 7 80512907 small insertion probably benign
R0133:Blm UTSW 7 80502367 missense possibly damaging 0.93
R0194:Blm UTSW 7 80464946 unclassified probably benign
R0526:Blm UTSW 7 80505893 nonsense probably null
R0673:Blm UTSW 7 80499751 critical splice donor site probably null
R0972:Blm UTSW 7 80513370 missense probably benign
R0980:Blm UTSW 7 80499958 splice site probably null
R1120:Blm UTSW 7 80481466 missense probably damaging 1.00
R1301:Blm UTSW 7 80455417 nonsense probably null
R1769:Blm UTSW 7 80513370 missense probably benign
R1866:Blm UTSW 7 80494114 missense probably benign 0.08
R1874:Blm UTSW 7 80497418 missense probably damaging 1.00
R1966:Blm UTSW 7 80513186 missense possibly damaging 0.86
R1991:Blm UTSW 7 80505949 splice site probably null
R2013:Blm UTSW 7 80502399 missense probably damaging 0.99
R2014:Blm UTSW 7 80502399 missense probably damaging 0.99
R2015:Blm UTSW 7 80502399 missense probably damaging 0.99
R2016:Blm UTSW 7 80505926 missense probably benign 0.26
R2103:Blm UTSW 7 80505949 splice site probably null
R2161:Blm UTSW 7 80481370 splice site probably null
R2215:Blm UTSW 7 80499847 missense possibly damaging 0.69
R3689:Blm UTSW 7 80513079 missense possibly damaging 0.56
R4049:Blm UTSW 7 80502862 missense probably benign 0.04
R4155:Blm UTSW 7 80512904 small deletion probably benign
R4695:Blm UTSW 7 80494228 missense probably damaging 1.00
R4774:Blm UTSW 7 80463848 missense probably damaging 1.00
R4833:Blm UTSW 7 80466826 missense probably benign
R4835:Blm UTSW 7 80509546 missense probably benign 0.41
R4994:Blm UTSW 7 80458825 missense probably benign 0.00
R5039:Blm UTSW 7 80505873 missense possibly damaging 0.50
R5330:Blm UTSW 7 80458936 missense possibly damaging 0.73
R5375:Blm UTSW 7 80513229 missense probably benign 0.00
R5408:Blm UTSW 7 80502622 missense probably benign 0.01
R5574:Blm UTSW 7 80499773 missense probably damaging 1.00
R5606:Blm UTSW 7 80460832 splice site probably null
R5702:Blm UTSW 7 80458927 missense probably benign 0.13
R5809:Blm UTSW 7 80464844 missense probably damaging 1.00
R6114:Blm UTSW 7 80513487 missense probably damaging 1.00
R6157:Blm UTSW 7 80512985 missense probably benign 0.18
R6163:Blm UTSW 7 80512904 small deletion probably benign
R6254:Blm UTSW 7 80480342 missense probably benign 0.04
R6266:Blm UTSW 7 80499940 missense probably benign 0.03
R6364:Blm UTSW 7 80494526 nonsense probably null
R6446:Blm UTSW 7 80512904 small deletion probably benign
R6502:Blm UTSW 7 80481475 missense probably damaging 0.98
R6700:Blm UTSW 7 80463850 missense possibly damaging 0.91
R7002:Blm UTSW 7 80469753 missense probably benign 0.00
R7105:Blm UTSW 7 80499768 missense probably benign 0.44
R7320:Blm UTSW 7 80455354 nonsense probably null
R7465:Blm UTSW 7 80513115 missense probably benign 0.02
R7561:Blm UTSW 7 80502528 missense probably damaging 0.99
R8500:Blm UTSW 7 80455284 missense probably damaging 1.00
R8543:Blm UTSW 7 80494216 missense probably damaging 0.98
R8774-TAIL:Blm UTSW 7 80512907 small insertion probably benign
R8774-TAIL:Blm UTSW 7 80512918 small insertion probably benign
R8774-TAIL:Blm UTSW 7 80512919 small insertion probably benign
R8775-TAIL:Blm UTSW 7 80512931 small insertion probably benign
R8860:Blm UTSW 7 80494528 missense probably benign 0.30
R8928:Blm UTSW 7 80512904 small deletion probably benign
R9089:Blm UTSW 7 80513119 missense probably damaging 1.00
R9363:Blm UTSW 7 80458915 missense probably damaging 1.00
RF001:Blm UTSW 7 80512903 small insertion probably benign
RF001:Blm UTSW 7 80512906 small insertion probably benign
RF001:Blm UTSW 7 80512927 small insertion probably benign
RF002:Blm UTSW 7 80512905 small insertion probably benign
RF007:Blm UTSW 7 80512933 nonsense probably null
RF016:Blm UTSW 7 80512926 nonsense probably null
RF018:Blm UTSW 7 80512926 nonsense probably null
RF027:Blm UTSW 7 80512914 frame shift probably null
RF028:Blm UTSW 7 80512905 nonsense probably null
RF031:Blm UTSW 7 80512906 small insertion probably benign
RF031:Blm UTSW 7 80512923 small insertion probably benign
RF032:Blm UTSW 7 80512930 small insertion probably benign
RF036:Blm UTSW 7 80512914 nonsense probably null
RF044:Blm UTSW 7 80512930 small insertion probably benign
RF053:Blm UTSW 7 80512921 small insertion probably benign
RF064:Blm UTSW 7 80512923 nonsense probably null
X0061:Blm UTSW 7 80458850 missense possibly damaging 0.89
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04