Incidental Mutation 'RF002:Fah'
ID602562
Institutional Source Beutler Lab
Gene Symbol Fah
Ensembl Gene ENSMUSG00000030630
Gene Namefumarylacetoacetate hydrolase
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF002 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location84585159-84606722 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 84589628 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 336 (N336K)
Ref Sequence ENSEMBL: ENSMUSP00000032865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032865]
PDB Structure CRYSTAL STRUCTURE OF FUMARYLACETOACETATE HYDROLASE COMPLEXED WITH 4-(HYDROXYMETHYLPHOSPHINOYL)-3-OXO-BUTANOIC ACID [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF FUMARYLACETOACETATE HYDROLASE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF FUMARYLACETOACETATE HYDROLASE COMPLEXED WITH FUMARATE AND ACETOACETATE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MOUSE FUMARYLACETOACETATE HYDROLASE REFINED AT 1.55 ANGSTROM RESOLUTION [X-RAY DIFFRACTION]
Mouse fumarylacetoacetate hydrolase complexes with a transition-state mimic of the complete substrate [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000032865
AA Change: N336K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000032865
Gene: ENSMUSG00000030630
AA Change: N336K

DomainStartEndE-ValueType
Pfam:FAA_hydrolase_N 15 118 1.7e-36 PFAM
Pfam:FAA_hydrolase 123 413 1e-58 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the last enzyme in the tyrosine catabolism pathway. FAH deficiency is associated with Type 1 hereditary tyrosinemia (HT). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted, deletion, and ENU-induced mutations die perinatally with liver and kidney dysfunction, hypoglycemia, and grossly altered liver mRNA expression. Mice homozygous for a mutation of this gene exhibit inappropriate bouts of activity during the light period of the circadian cycle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,235 probably benign Het
Angptl1 A T 1: 156,857,224 Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 51,805,593 probably null Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably benign Het
Blm CTC CTCATCCTCCTCATC 7: 80,512,927 probably benign Het
Car13 T C 3: 14,654,914 Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,712,523 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cdh26 T C 2: 178,466,631 C341R probably damaging Het
Chga GCA GCACCA 12: 102,561,421 probably benign Het
Col11a1 A T 3: 114,217,001 I1689L unknown Het
Dnah6 T G 6: 73,101,889 S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,455,186 probably benign Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Fbxo11 A T 17: 87,996,053 I664K Het
Fcgbp A G 7: 28,089,755 D582G probably benign Het
Gabre C CCGGCTA X: 72,270,057 probably null Het
Gm1110 A G 9: 26,920,640 Y72H probably damaging Het
Gm14025 A G 2: 129,038,794 F404S Het
Inpp5e C T 2: 26,408,377 A71T possibly damaging Het
Iqcm C T 8: 75,577,899 T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 93,018,283 probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 93,018,299 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lyst A G 13: 13,634,363 D206G probably benign Het
Map4k5 A T 12: 69,856,856 D58E probably damaging Het
Mapkapk2 A G 1: 131,056,513 S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,652,529 probably benign Het
Men1 T C 19: 6,340,116 S600P probably damaging Het
Mllt1 C T 17: 56,896,300 V394M probably benign Het
Mllt1 C A 17: 56,896,301 M393I possibly damaging Het
Nacc1 T C 8: 84,676,219 E315G possibly damaging Het
Nefh GGGGACTTGGCCTC GGGGACTTGGCCTCACCTAGGGACTTGGCCTC 11: 4,941,047 probably benign Het
Nefh GACTTGGCCTC GACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,050 probably benign Het
Nid2 TAACACCGCCA TA 14: 19,751,366 probably benign Het
Olfr1484 T A 19: 13,586,051 I206N probably damaging Het
Parp2 A G 14: 50,817,386 E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,279,375 probably null Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Ppp3cc T C 14: 70,267,339 T73A possibly damaging Het
Prdm15 C T 16: 97,799,629 D810N probably damaging Het
Prpf4b T A 13: 34,884,236 S349R unknown Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,608,921 probably benign Het
Rassf6 GTAGAGCAATGGGGATTC GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC 5: 90,608,925 probably null Het
Sdk2 T C 11: 113,885,252 E208G probably benign Het
Smurf2 G T 11: 106,852,587 P211Q probably benign Het
Snx25 C A 8: 46,116,181 probably null Het
Spata6 T A 4: 111,828,305 M469K probably benign Het
Spta1 G T 1: 174,231,360 A1954S possibly damaging Het
Sry CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG CTGGTCATGGAACTGCTG Y: 2,662,564 probably benign Het
Stard8 GAG GAGTAG X: 99,066,515 probably null Het
Tfeb AGC AGCGGC 17: 47,786,102 probably benign Het
Tlcd1 T A 11: 78,180,194 L203Q probably benign Het
Tlr11 T C 14: 50,361,225 F223L possibly damaging Het
Usp48 T A 4: 137,605,795 V100D probably damaging Het
Vmn2r56 G A 7: 12,694,830 T503I probably benign Het
Vps18 T C 2: 119,297,390 L898P probably damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp706 T A 15: 37,003,705 Y39F probably benign Het
Zhx3 T A 2: 160,781,806 N147I probably damaging Het
Other mutations in Fah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01798:Fah APN 7 84589629 missense probably benign 0.33
IGL02374:Fah APN 7 84605701 missense probably benign 0.02
IGL02975:Fah APN 7 84601079 missense probably benign 0.00
IGL03403:Fah APN 7 84593209 missense probably damaging 1.00
R0245:Fah UTSW 7 84595498 missense probably benign
R0689:Fah UTSW 7 84593184 critical splice donor site probably null
R1173:Fah UTSW 7 84601136 start codon destroyed probably null 1.00
R1413:Fah UTSW 7 84593212 missense probably damaging 0.99
R1995:Fah UTSW 7 84602181 missense probably damaging 1.00
R2150:Fah UTSW 7 84594834 missense probably damaging 1.00
R3612:Fah UTSW 7 84585290 missense probably damaging 0.98
R3620:Fah UTSW 7 84588951 splice site probably null
R4360:Fah UTSW 7 84589648 missense probably damaging 1.00
R4386:Fah UTSW 7 84599136 missense probably damaging 1.00
R4923:Fah UTSW 7 84602052 intron probably benign
R5151:Fah UTSW 7 84601051 missense possibly damaging 0.87
R5443:Fah UTSW 7 84592396 missense probably damaging 0.96
R5470:Fah UTSW 7 84593185 critical splice donor site probably null
R5976:Fah UTSW 7 84594741 missense probably benign 0.00
R6086:Fah UTSW 7 84588912 missense probably damaging 1.00
R6272:Fah UTSW 7 84595545 missense probably damaging 1.00
R6502:Fah UTSW 7 84594835 missense probably damaging 1.00
R6586:Fah UTSW 7 84593260 missense probably benign 0.04
R7522:Fah UTSW 7 84597074 missense probably benign 0.00
R7832:Fah UTSW 7 84595478 missense probably damaging 1.00
R8535:Fah UTSW 7 84601097 missense probably benign
R8823:Fah UTSW 7 84605717 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CTCTGGTTCTCACACAGGTC -3'
(R):5'- GCAGCAGGTCATCTAGAAGG -3'

Sequencing Primer
(F):5'- ACACAGGTCTCTCTTGGTCTATGTG -3'
(R):5'- GGCAAAATCTCAATTAAAATGAGGC -3'
Posted On2019-12-04