Incidental Mutation 'RF002:Mcph1'
ID 602563
Institutional Source Beutler Lab
Gene Symbol Mcph1
Ensembl Gene ENSMUSG00000039842
Gene Name microcephaly, primary autosomal recessive 1
Synonyms 5430437K10Rik, D030046N04Rik, BRIT1
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # RF002 (G1)
Quality Score 139.467
Status Not validated
Chromosome 8
Chromosomal Location 18645147-18853205 bp(+) (GRCm39)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) CCTG to CCTGCTG at 18702545 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039412] [ENSMUST00000124910] [ENSMUST00000141244]
AlphaFold Q7TT79
Predicted Effect probably benign
Transcript: ENSMUST00000039412
SMART Domains Protein: ENSMUSP00000037000
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
BRCT 13 89 2.64e-4 SMART
coiled coil region 128 155 N/A INTRINSIC
Pfam:Microcephalin 224 597 1.2e-143 PFAM
BRCT 624 707 2.23e-2 SMART
BRCT 740 810 1.55e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124910
SMART Domains Protein: ENSMUSP00000131698
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
BRCT 13 89 2.64e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141244
SMART Domains Protein: ENSMUSP00000119267
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
Blast:BRCT 2 38 2e-9 BLAST
low complexity region 39 51 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA damage response protein. The encoded protein may play a role in G2/M checkpoint arrest via maintenance of inhibitory phosphorylation of cyclin-dependent kinase 1. Mutations in this gene have been associated with primary autosomal recessive microcephaly 1 and premature chromosome condensation syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous null mice are born at a reduced rate and display male and female infertility and arrest of male meiosis. Mice homozygous for another knock-out allele exhibit microcephaly, infertility, decreased brain size, impaired neuroprogenitor proliferation and apoptosis, and mitosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,475,262 (GRCm39) probably benign Het
AI837181 GGC GGCTGC 19: 5,475,263 (GRCm39) probably benign Het
Angptl1 A T 1: 156,684,794 (GRCm39) Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 52,043,050 (GRCm39) probably null Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT 7: 80,162,653 (GRCm39) probably benign Het
Blm CTC CTCATCCTCCTCATC 7: 80,162,675 (GRCm39) probably benign Het
Car13 T C 3: 14,719,974 (GRCm39) Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,619,805 (GRCm39) probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,619,810 (GRCm39) probably benign Het
Cdh26 T C 2: 178,108,424 (GRCm39) C341R probably damaging Het
Chga GCA GCACCA 12: 102,527,680 (GRCm39) probably benign Het
Col11a1 A T 3: 114,010,650 (GRCm39) I1689L unknown Het
Dnah6 T G 6: 73,078,872 (GRCm39) S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,674,160 (GRCm39) probably benign Het
Fah A C 7: 84,238,836 (GRCm39) N336K probably damaging Het
Fbxo11 A T 17: 88,303,481 (GRCm39) I664K Het
Fcgbp A G 7: 27,789,180 (GRCm39) D582G probably benign Het
Gabre C CCGGCTA X: 71,313,663 (GRCm39) probably null Het
Garin5a CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA 7: 44,149,944 (GRCm39) probably null Het
Gm1110 A G 9: 26,831,936 (GRCm39) Y72H probably damaging Het
Inpp5e C T 2: 26,298,389 (GRCm39) A71T possibly damaging Het
Iqcm C T 8: 76,304,527 (GRCm39) T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 92,925,590 (GRCm39) probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 92,925,606 (GRCm39) probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 75,185,014 (GRCm39) probably benign Het
Lyst A G 13: 13,808,948 (GRCm39) D206G probably benign Het
Map4k5 A T 12: 69,903,630 (GRCm39) D58E probably damaging Het
Mapkapk2 A G 1: 130,984,250 (GRCm39) S251P probably damaging Het
Men1 T C 19: 6,390,146 (GRCm39) S600P probably damaging Het
Mllt1 C T 17: 57,203,300 (GRCm39) V394M probably benign Het
Mllt1 C A 17: 57,203,301 (GRCm39) M393I possibly damaging Het
Nacc1 T C 8: 85,402,848 (GRCm39) E315G possibly damaging Het
Nefh GGGGACTTGGCCTC GGGGACTTGGCCTCACCTAGGGACTTGGCCTC 11: 4,891,047 (GRCm39) probably benign Het
Nefh GACTTGGCCTC GACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,050 (GRCm39) probably benign Het
Nid2 TAACACCGCCA TA 14: 19,801,434 (GRCm39) probably benign Het
Or5b122 T A 19: 13,563,415 (GRCm39) I206N probably damaging Het
Parp2 A G 14: 51,054,843 (GRCm39) E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,006,686 (GRCm39) probably null Het
Pop1 G A 15: 34,502,583 (GRCm39) G90D probably damaging Het
Ppp3cc T C 14: 70,504,788 (GRCm39) T73A possibly damaging Het
Prdm15 C T 16: 97,600,829 (GRCm39) D810N probably damaging Het
Prpf4b T A 13: 35,068,219 (GRCm39) S349R unknown Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,756,780 (GRCm39) probably benign Het
Rassf6 GTAGAGCAATGGGGATTC GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC 5: 90,756,784 (GRCm39) probably null Het
Sdk2 T C 11: 113,776,078 (GRCm39) E208G probably benign Het
Smurf2 G T 11: 106,743,413 (GRCm39) P211Q probably benign Het
Snx25 C A 8: 46,569,218 (GRCm39) probably null Het
Spata6 T A 4: 111,685,502 (GRCm39) M469K probably benign Het
Spta1 G T 1: 174,058,926 (GRCm39) A1954S possibly damaging Het
Sry CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG CTGGTCATGGAACTGCTG Y: 2,662,564 (GRCm39) probably benign Het
Stard8 GAG GAGTAG X: 98,110,121 (GRCm39) probably null Het
Tfeb AGC AGCGGC 17: 48,097,027 (GRCm39) probably benign Het
Tlcd1 T A 11: 78,071,020 (GRCm39) L203Q probably benign Het
Tlr11 T C 14: 50,598,682 (GRCm39) F223L possibly damaging Het
Usp48 T A 4: 137,333,106 (GRCm39) V100D probably damaging Het
Vinac1 A G 2: 128,880,714 (GRCm39) F404S Het
Vmn2r56 G A 7: 12,428,757 (GRCm39) T503I probably benign Het
Vps18 T C 2: 119,127,871 (GRCm39) L898P probably damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,013,434 (GRCm39) probably benign Het
Zfp706 T A 15: 37,003,949 (GRCm39) Y39F probably benign Het
Zhx3 T A 2: 160,623,726 (GRCm39) N147I probably damaging Het
Other mutations in Mcph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Mcph1 APN 8 18,682,636 (GRCm39) missense possibly damaging 0.95
IGL00816:Mcph1 APN 8 18,682,413 (GRCm39) missense possibly damaging 0.59
IGL01432:Mcph1 APN 8 18,675,655 (GRCm39) missense probably damaging 0.99
IGL01674:Mcph1 APN 8 18,681,535 (GRCm39) missense probably damaging 1.00
IGL01746:Mcph1 APN 8 18,721,143 (GRCm39) missense probably damaging 1.00
IGL01788:Mcph1 APN 8 18,682,420 (GRCm39) missense probably damaging 1.00
IGL01788:Mcph1 APN 8 18,682,419 (GRCm39) missense probably damaging 1.00
IGL02185:Mcph1 APN 8 18,719,006 (GRCm39) splice site probably benign
IGL02677:Mcph1 APN 8 18,675,609 (GRCm39) missense probably damaging 1.00
IGL03376:Mcph1 APN 8 18,646,989 (GRCm39) missense probably damaging 0.99
PIT4514001:Mcph1 UTSW 8 18,681,906 (GRCm39) missense probably damaging 0.99
R0116:Mcph1 UTSW 8 18,838,264 (GRCm39) missense probably benign 0.06
R0189:Mcph1 UTSW 8 18,838,487 (GRCm39) missense probably damaging 0.96
R1510:Mcph1 UTSW 8 18,682,703 (GRCm39) splice site probably null
R1547:Mcph1 UTSW 8 18,672,702 (GRCm39) missense possibly damaging 0.65
R1574:Mcph1 UTSW 8 18,851,428 (GRCm39) missense probably damaging 0.99
R1574:Mcph1 UTSW 8 18,851,428 (GRCm39) missense probably damaging 0.99
R1733:Mcph1 UTSW 8 18,681,979 (GRCm39) missense probably benign 0.18
R1742:Mcph1 UTSW 8 18,657,379 (GRCm39) missense probably benign 0.03
R1975:Mcph1 UTSW 8 18,739,081 (GRCm39) splice site probably benign
R3836:Mcph1 UTSW 8 18,672,675 (GRCm39) missense possibly damaging 0.91
R4405:Mcph1 UTSW 8 18,682,557 (GRCm39) missense probably benign 0.00
R4493:Mcph1 UTSW 8 18,681,752 (GRCm39) nonsense probably null
R4824:Mcph1 UTSW 8 18,682,703 (GRCm39) splice site probably null
R4873:Mcph1 UTSW 8 18,675,574 (GRCm39) critical splice acceptor site probably null
R4875:Mcph1 UTSW 8 18,675,574 (GRCm39) critical splice acceptor site probably null
R5125:Mcph1 UTSW 8 18,657,342 (GRCm39) missense probably damaging 0.98
R5178:Mcph1 UTSW 8 18,657,342 (GRCm39) missense probably damaging 0.98
R5217:Mcph1 UTSW 8 18,838,489 (GRCm39) missense probably damaging 0.99
R5233:Mcph1 UTSW 8 18,721,254 (GRCm39) missense probably damaging 0.96
R5299:Mcph1 UTSW 8 18,702,596 (GRCm39) intron probably benign
R5335:Mcph1 UTSW 8 18,739,077 (GRCm39) critical splice donor site probably null
R5579:Mcph1 UTSW 8 18,682,309 (GRCm39) missense probably benign 0.18
R5621:Mcph1 UTSW 8 18,682,186 (GRCm39) missense probably damaging 1.00
R5655:Mcph1 UTSW 8 18,838,326 (GRCm39) missense probably benign 0.02
R5721:Mcph1 UTSW 8 18,721,223 (GRCm39) missense probably damaging 0.99
R6076:Mcph1 UTSW 8 18,682,015 (GRCm39) missense probably benign 0.40
R6592:Mcph1 UTSW 8 18,718,983 (GRCm39) missense probably damaging 0.97
R7269:Mcph1 UTSW 8 18,657,288 (GRCm39) splice site probably null
R7446:Mcph1 UTSW 8 18,721,109 (GRCm39) missense probably benign 0.00
R7455:Mcph1 UTSW 8 18,681,775 (GRCm39) missense probably benign 0.26
R7542:Mcph1 UTSW 8 18,681,705 (GRCm39) missense probably benign 0.03
R7640:Mcph1 UTSW 8 18,682,342 (GRCm39) missense probably benign 0.00
R7703:Mcph1 UTSW 8 18,721,122 (GRCm39) missense possibly damaging 0.82
R9045:Mcph1 UTSW 8 18,682,443 (GRCm39) missense probably benign 0.00
R9287:Mcph1 UTSW 8 18,657,293 (GRCm39) critical splice acceptor site probably null
RF035:Mcph1 UTSW 8 18,702,541 (GRCm39) small insertion probably benign
RF059:Mcph1 UTSW 8 18,702,541 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TTGAATCTGGCTACGGGAAG -3'
(R):5'- AAGAGGTCTTGACTGCCATC -3'

Sequencing Primer
(F):5'- AGCCTGAATAGTACCCTGTGG -3'
(R):5'- TCAAGGGCCAAAGGACTTTAAC -3'
Posted On 2019-12-04