Incidental Mutation 'RF002:Mcph1'
ID602563
Institutional Source Beutler Lab
Gene Symbol Mcph1
Ensembl Gene ENSMUSG00000039842
Gene Namemicrocephaly, primary autosomal recessive 1
SynonymsBRIT1, D030046N04Rik, 5430437K10Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF002 (G1)
Quality Score139.467
Status Not validated
Chromosome8
Chromosomal Location18595131-18803189 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) CCTG to CCTGCTG at 18652529 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039412] [ENSMUST00000124910] [ENSMUST00000141244]
Predicted Effect probably benign
Transcript: ENSMUST00000039412
SMART Domains Protein: ENSMUSP00000037000
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
BRCT 13 89 2.64e-4 SMART
coiled coil region 128 155 N/A INTRINSIC
Pfam:Microcephalin 224 597 1.2e-143 PFAM
BRCT 624 707 2.23e-2 SMART
BRCT 740 810 1.55e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124910
SMART Domains Protein: ENSMUSP00000131698
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
BRCT 13 89 2.64e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141244
SMART Domains Protein: ENSMUSP00000119267
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
Blast:BRCT 2 38 2e-9 BLAST
low complexity region 39 51 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA damage response protein. The encoded protein may play a role in G2/M checkpoint arrest via maintenance of inhibitory phosphorylation of cyclin-dependent kinase 1. Mutations in this gene have been associated with primary autosomal recessive microcephaly 1 and premature chromosome condensation syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous null mice are born at a reduced rate and display male and female infertility and arrest of male meiosis. Mice homozygous for another knock-out allele exhibit microcephaly, infertility, decreased brain size, impaired neuroprogenitor proliferation and apoptosis, and mitosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,235 probably benign Het
Angptl1 A T 1: 156,857,224 Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 51,805,593 probably null Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably benign Het
Blm CTC CTCATCCTCCTCATC 7: 80,512,927 probably benign Het
Car13 T C 3: 14,654,914 Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,712,523 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cdh26 T C 2: 178,466,631 C341R probably damaging Het
Chga GCA GCACCA 12: 102,561,421 probably benign Het
Col11a1 A T 3: 114,217,001 I1689L unknown Het
Dnah6 T G 6: 73,101,889 S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,455,186 probably benign Het
Fah A C 7: 84,589,628 N336K probably damaging Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Fbxo11 A T 17: 87,996,053 I664K Het
Fcgbp A G 7: 28,089,755 D582G probably benign Het
Gabre C CCGGCTA X: 72,270,057 probably null Het
Gm1110 A G 9: 26,920,640 Y72H probably damaging Het
Gm14025 A G 2: 129,038,794 F404S Het
Inpp5e C T 2: 26,408,377 A71T possibly damaging Het
Iqcm C T 8: 75,577,899 T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 93,018,283 probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 93,018,299 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lyst A G 13: 13,634,363 D206G probably benign Het
Map4k5 A T 12: 69,856,856 D58E probably damaging Het
Mapkapk2 A G 1: 131,056,513 S251P probably damaging Het
Men1 T C 19: 6,340,116 S600P probably damaging Het
Mllt1 C T 17: 56,896,300 V394M probably benign Het
Mllt1 C A 17: 56,896,301 M393I possibly damaging Het
Nacc1 T C 8: 84,676,219 E315G possibly damaging Het
Nefh GGGGACTTGGCCTC GGGGACTTGGCCTCACCTAGGGACTTGGCCTC 11: 4,941,047 probably benign Het
Nefh GACTTGGCCTC GACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,050 probably benign Het
Nid2 TAACACCGCCA TA 14: 19,751,366 probably benign Het
Olfr1484 T A 19: 13,586,051 I206N probably damaging Het
Parp2 A G 14: 50,817,386 E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,279,375 probably null Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Ppp3cc T C 14: 70,267,339 T73A possibly damaging Het
Prdm15 C T 16: 97,799,629 D810N probably damaging Het
Prpf4b T A 13: 34,884,236 S349R unknown Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,608,921 probably benign Het
Rassf6 GTAGAGCAATGGGGATTC GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC 5: 90,608,925 probably null Het
Sdk2 T C 11: 113,885,252 E208G probably benign Het
Smurf2 G T 11: 106,852,587 P211Q probably benign Het
Snx25 C A 8: 46,116,181 probably null Het
Spata6 T A 4: 111,828,305 M469K probably benign Het
Spta1 G T 1: 174,231,360 A1954S possibly damaging Het
Sry CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG CTGGTCATGGAACTGCTG Y: 2,662,564 probably benign Het
Stard8 GAG GAGTAG X: 99,066,515 probably null Het
Tfeb AGC AGCGGC 17: 47,786,102 probably benign Het
Tlcd1 T A 11: 78,180,194 L203Q probably benign Het
Tlr11 T C 14: 50,361,225 F223L possibly damaging Het
Usp48 T A 4: 137,605,795 V100D probably damaging Het
Vmn2r56 G A 7: 12,694,830 T503I probably benign Het
Vps18 T C 2: 119,297,390 L898P probably damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp706 T A 15: 37,003,705 Y39F probably benign Het
Zhx3 T A 2: 160,781,806 N147I probably damaging Het
Other mutations in Mcph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Mcph1 APN 8 18632620 missense possibly damaging 0.95
IGL00816:Mcph1 APN 8 18632397 missense possibly damaging 0.59
IGL01432:Mcph1 APN 8 18625639 missense probably damaging 0.99
IGL01674:Mcph1 APN 8 18631519 missense probably damaging 1.00
IGL01746:Mcph1 APN 8 18671127 missense probably damaging 1.00
IGL01788:Mcph1 APN 8 18632403 missense probably damaging 1.00
IGL01788:Mcph1 APN 8 18632404 missense probably damaging 1.00
IGL02185:Mcph1 APN 8 18668990 splice site probably benign
IGL02677:Mcph1 APN 8 18625593 missense probably damaging 1.00
IGL03376:Mcph1 APN 8 18596973 missense probably damaging 0.99
PIT4514001:Mcph1 UTSW 8 18631890 missense probably damaging 0.99
R0116:Mcph1 UTSW 8 18788248 missense probably benign 0.06
R0189:Mcph1 UTSW 8 18788471 missense probably damaging 0.96
R1510:Mcph1 UTSW 8 18632687 splice site probably null
R1547:Mcph1 UTSW 8 18622686 missense possibly damaging 0.65
R1574:Mcph1 UTSW 8 18801412 missense probably damaging 0.99
R1574:Mcph1 UTSW 8 18801412 missense probably damaging 0.99
R1733:Mcph1 UTSW 8 18631963 missense probably benign 0.18
R1742:Mcph1 UTSW 8 18607363 missense probably benign 0.03
R1975:Mcph1 UTSW 8 18689065 splice site probably benign
R3836:Mcph1 UTSW 8 18622659 missense possibly damaging 0.91
R4405:Mcph1 UTSW 8 18632541 missense probably benign 0.00
R4493:Mcph1 UTSW 8 18631736 nonsense probably null
R4824:Mcph1 UTSW 8 18632687 splice site probably null
R4873:Mcph1 UTSW 8 18625558 critical splice acceptor site probably null
R4875:Mcph1 UTSW 8 18625558 critical splice acceptor site probably null
R5125:Mcph1 UTSW 8 18607326 missense probably damaging 0.98
R5178:Mcph1 UTSW 8 18607326 missense probably damaging 0.98
R5217:Mcph1 UTSW 8 18788473 missense probably damaging 0.99
R5233:Mcph1 UTSW 8 18671238 missense probably damaging 0.96
R5299:Mcph1 UTSW 8 18652580 intron probably benign
R5335:Mcph1 UTSW 8 18689061 critical splice donor site probably null
R5579:Mcph1 UTSW 8 18632293 missense probably benign 0.18
R5621:Mcph1 UTSW 8 18632170 missense probably damaging 1.00
R5655:Mcph1 UTSW 8 18788310 missense probably benign 0.02
R5721:Mcph1 UTSW 8 18671207 missense probably damaging 0.99
R6076:Mcph1 UTSW 8 18631999 missense probably benign 0.40
R6592:Mcph1 UTSW 8 18668967 missense probably damaging 0.97
R7269:Mcph1 UTSW 8 18607272 splice site probably null
R7446:Mcph1 UTSW 8 18671093 missense probably benign 0.00
R7455:Mcph1 UTSW 8 18631759 missense probably benign 0.26
R7542:Mcph1 UTSW 8 18631689 missense probably benign 0.03
R7640:Mcph1 UTSW 8 18632326 missense probably benign 0.00
R7703:Mcph1 UTSW 8 18671106 missense possibly damaging 0.82
R9045:Mcph1 UTSW 8 18632427 missense probably benign 0.00
RF035:Mcph1 UTSW 8 18652525 small insertion probably benign
RF059:Mcph1 UTSW 8 18652525 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TTGAATCTGGCTACGGGAAG -3'
(R):5'- AAGAGGTCTTGACTGCCATC -3'

Sequencing Primer
(F):5'- AGCCTGAATAGTACCCTGTGG -3'
(R):5'- TCAAGGGCCAAAGGACTTTAAC -3'
Posted On2019-12-04