Incidental Mutation 'RF002:Snx25'
ID 602564
Institutional Source Beutler Lab
Gene Symbol Snx25
Ensembl Gene ENSMUSG00000038291
Gene Name sorting nexin 25
Synonyms LOC382008, SBBI31
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # RF002 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 46033261-46152159 bp(-) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 46116181 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041582] [ENSMUST00000110377] [ENSMUST00000110378] [ENSMUST00000170416]
AlphaFold Q3ZT31
Predicted Effect probably null
Transcript: ENSMUST00000041582
SMART Domains Protein: ENSMUSP00000035785
Gene: ENSMUSG00000038291

DomainStartEndE-ValueType
Pfam:PXA 1 163 9e-32 PFAM
RGS 287 401 6.62e-10 SMART
low complexity region 421 438 N/A INTRINSIC
PX 512 624 1.38e-10 SMART
low complexity region 658 663 N/A INTRINSIC
low complexity region 664 676 N/A INTRINSIC
Pfam:Nexin_C 701 808 1.7e-35 PFAM
low complexity region 812 828 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110377
SMART Domains Protein: ENSMUSP00000106006
Gene: ENSMUSG00000038291

DomainStartEndE-ValueType
Pfam:PXA 1 138 5.8e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110378
SMART Domains Protein: ENSMUSP00000106007
Gene: ENSMUSG00000038291

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
Pfam:PXA 145 306 8.7e-30 PFAM
RGS 433 547 6.62e-10 SMART
low complexity region 567 584 N/A INTRINSIC
PX 658 770 1.38e-10 SMART
low complexity region 804 809 N/A INTRINSIC
low complexity region 810 822 N/A INTRINSIC
Pfam:Nexin_C 847 953 1e-28 PFAM
low complexity region 958 974 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170416
SMART Domains Protein: ENSMUSP00000127640
Gene: ENSMUSG00000038291

DomainStartEndE-ValueType
Pfam:PXA 1 163 9e-32 PFAM
RGS 287 401 6.62e-10 SMART
low complexity region 421 438 N/A INTRINSIC
PX 512 624 1.38e-10 SMART
low complexity region 658 663 N/A INTRINSIC
low complexity region 664 676 N/A INTRINSIC
Pfam:Nexin_C 701 808 1.7e-35 PFAM
low complexity region 812 828 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,235 probably benign Het
Angptl1 A T 1: 156,857,224 Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 51,805,593 probably null Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably benign Het
Blm CTC CTCATCCTCCTCATC 7: 80,512,927 probably benign Het
Car13 T C 3: 14,654,914 Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,712,523 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cdh26 T C 2: 178,466,631 C341R probably damaging Het
Chga GCA GCACCA 12: 102,561,421 probably benign Het
Col11a1 A T 3: 114,217,001 I1689L unknown Het
Dnah6 T G 6: 73,101,889 S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,455,186 probably benign Het
Fah A C 7: 84,589,628 N336K probably damaging Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Fbxo11 A T 17: 87,996,053 I664K Het
Fcgbp A G 7: 28,089,755 D582G probably benign Het
Gabre C CCGGCTA X: 72,270,057 probably null Het
Gm1110 A G 9: 26,920,640 Y72H probably damaging Het
Gm14025 A G 2: 129,038,794 F404S Het
Inpp5e C T 2: 26,408,377 A71T possibly damaging Het
Iqcm C T 8: 75,577,899 T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 93,018,283 probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 93,018,299 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lyst A G 13: 13,634,363 D206G probably benign Het
Map4k5 A T 12: 69,856,856 D58E probably damaging Het
Mapkapk2 A G 1: 131,056,513 S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,652,529 probably benign Het
Men1 T C 19: 6,340,116 S600P probably damaging Het
Mllt1 C T 17: 56,896,300 V394M probably benign Het
Mllt1 C A 17: 56,896,301 M393I possibly damaging Het
Nacc1 T C 8: 84,676,219 E315G possibly damaging Het
Nefh GGGGACTTGGCCTC GGGGACTTGGCCTCACCTAGGGACTTGGCCTC 11: 4,941,047 probably benign Het
Nefh GACTTGGCCTC GACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,050 probably benign Het
Nid2 TAACACCGCCA TA 14: 19,751,366 probably benign Het
Olfr1484 T A 19: 13,586,051 I206N probably damaging Het
Parp2 A G 14: 50,817,386 E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,279,375 probably null Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Ppp3cc T C 14: 70,267,339 T73A possibly damaging Het
Prdm15 C T 16: 97,799,629 D810N probably damaging Het
Prpf4b T A 13: 34,884,236 S349R unknown Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,608,921 probably benign Het
Rassf6 GTAGAGCAATGGGGATTC GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC 5: 90,608,925 probably null Het
Sdk2 T C 11: 113,885,252 E208G probably benign Het
Smurf2 G T 11: 106,852,587 P211Q probably benign Het
Spata6 T A 4: 111,828,305 M469K probably benign Het
Spta1 G T 1: 174,231,360 A1954S possibly damaging Het
Sry CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG CTGGTCATGGAACTGCTG Y: 2,662,564 probably benign Het
Stard8 GAG GAGTAG X: 99,066,515 probably null Het
Tfeb AGC AGCGGC 17: 47,786,102 probably benign Het
Tlcd1 T A 11: 78,180,194 L203Q probably benign Het
Tlr11 T C 14: 50,361,225 F223L possibly damaging Het
Usp48 T A 4: 137,605,795 V100D probably damaging Het
Vmn2r56 G A 7: 12,694,830 T503I probably benign Het
Vps18 T C 2: 119,297,390 L898P probably damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp706 T A 15: 37,003,705 Y39F probably benign Het
Zhx3 T A 2: 160,781,806 N147I probably damaging Het
Other mutations in Snx25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Snx25 APN 8 46038476 missense probably damaging 1.00
IGL01432:Snx25 APN 8 46105160 missense probably damaging 0.96
IGL01600:Snx25 APN 8 46116310 missense probably benign 0.00
IGL02150:Snx25 APN 8 46116281 missense possibly damaging 0.89
IGL02386:Snx25 APN 8 46041349 missense possibly damaging 0.93
IGL02691:Snx25 APN 8 46105265 missense possibly damaging 0.88
IGL03338:Snx25 APN 8 46045210 missense probably benign 0.04
IGL03377:Snx25 APN 8 46080301 unclassified probably benign
duo UTSW 8 46124082 start codon destroyed probably null 0.88
R0047:Snx25 UTSW 8 46041365 missense probably damaging 0.99
R0047:Snx25 UTSW 8 46041365 missense probably damaging 0.99
R0048:Snx25 UTSW 8 46105109 splice site probably benign
R0048:Snx25 UTSW 8 46105109 splice site probably benign
R0056:Snx25 UTSW 8 46038513 missense probably damaging 1.00
R0546:Snx25 UTSW 8 46103630 missense probably benign 0.00
R0791:Snx25 UTSW 8 46124082 start codon destroyed probably null 0.88
R1165:Snx25 UTSW 8 46035715 missense probably damaging 0.99
R1255:Snx25 UTSW 8 46116238 missense probably benign 0.13
R1262:Snx25 UTSW 8 46105291 missense probably damaging 0.98
R1522:Snx25 UTSW 8 46124082 start codon destroyed probably null 0.88
R1652:Snx25 UTSW 8 46049473 missense probably damaging 0.99
R1710:Snx25 UTSW 8 46116207 missense possibly damaging 0.69
R1829:Snx25 UTSW 8 46035632 missense possibly damaging 0.82
R2090:Snx25 UTSW 8 46056113 missense probably damaging 1.00
R2158:Snx25 UTSW 8 46041407 missense probably damaging 1.00
R2906:Snx25 UTSW 8 46049523 splice site probably null
R4244:Snx25 UTSW 8 46105254 missense probably damaging 0.98
R4394:Snx25 UTSW 8 46035678 missense probably damaging 1.00
R4465:Snx25 UTSW 8 46068229 missense possibly damaging 0.78
R4586:Snx25 UTSW 8 46116437 intron probably benign
R4663:Snx25 UTSW 8 46035579 missense probably damaging 1.00
R4961:Snx25 UTSW 8 46068192 missense probably damaging 0.99
R5104:Snx25 UTSW 8 46068166 makesense probably null
R5634:Snx25 UTSW 8 46041391 missense possibly damaging 0.94
R6128:Snx25 UTSW 8 46105203 missense probably benign 0.01
R6344:Snx25 UTSW 8 46035638 nonsense probably null
R6382:Snx25 UTSW 8 46055991 missense probably benign
R6523:Snx25 UTSW 8 46055855 missense probably damaging 0.96
R6798:Snx25 UTSW 8 46033773 missense probably damaging 0.98
R7143:Snx25 UTSW 8 46035715 missense possibly damaging 0.92
R7147:Snx25 UTSW 8 46105196 missense probably damaging 0.98
R7519:Snx25 UTSW 8 46116272 missense probably damaging 1.00
R7723:Snx25 UTSW 8 46038479 missense probably damaging 1.00
R9084:Snx25 UTSW 8 46068166 makesense probably null
Predicted Primers PCR Primer
(F):5'- GTCAAGCAGGCAAACCATTC -3'
(R):5'- GAACCTCAGCAGAGATGACG -3'

Sequencing Primer
(F):5'- AGCGTGAGTATGCTTAACCC -3'
(R):5'- GATGACGGACAGCTCTACCATCTG -3'
Posted On 2019-12-04