Mutagenetix > Incidental Mutation

Incidental Mutation 'RF002:Cd109'

602569

Institutional Source

Beutler Lab

Gene Symbol

Cd109

Ensembl Gene

ENSMUSG00000046186

Gene Name

CD109 antigen

Synonyms

Gov platelet alloantigens, 9930012E15Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

RF002 (G1)

Quality Score

217.468

Status

Not validated

Chromosome

Chromosomal Location

78615546-78716253 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

TATTTAT to TATTTATTTATTCATTTAT at 78712528 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000091330 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093812]

AlphaFold

Q8R422

Predicted Effect

probably benign
Transcript: ENSMUST00000093812

SMART Domains

Protein: ENSMUSP00000091330
Gene: ENSMUSG00000046186

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:A2M_N	129	220	1.5e-16	PFAM
A2M_N_2	470	601	8.89e-32	SMART
A2M	695	786	2.07e-32	SMART
Pfam:Thiol-ester_cl	912	941	2.6e-20	PFAM
Pfam:A2M_comp	961	1197	1.9e-65	PFAM
low complexity region	1265	1275	N/A	INTRINSIC
A2M_recep	1311	1395	2.06e-27	SMART
low complexity region	1422	1437	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.4%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl phosphatidylinositol (GPI)-linked glycoprotein that localizes to the surface of platelets, activated T-cells, and endothelial cells. The protein binds to and negatively regulates signalling by transforming growth factor beta (TGF-beta). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a null mutation display epidermal hyperplasia and thickening, sebaceous gland hyperplasia and transient impairment of hair growth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AI837181	CGG	CGGTGG	19: 5,425,234		probably benign	Het
AI837181	GGC	GGCTGC	19: 5,425,235		probably benign	Het
Angptl1	A	T	1: 156,857,224	Q321L	possibly damaging	Het
AY358078	T	TAGGATAATGC	14: 51,805,593		probably null	Het
Blm	CCTCCTCCTCCTCCTCCTCCTCCT	CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT	7: 80,512,905		probably benign	Het
Blm	CTC	CTCATCCTCCTCATC	7: 80,512,927		probably benign	Het
Car13	T	C	3: 14,654,914	Y129H	probably damaging	Het
Cdh26	T	C	2: 178,466,631	C341R	probably damaging	Het
Chga	GCA	GCACCA	12: 102,561,421		probably benign	Het
Col11a1	A	T	3: 114,217,001	I1689L	unknown	Het
Dnah6	T	G	6: 73,101,889	S2364R	probably benign	Het
E4f1	CCG	CCGACG	17: 24,455,186		probably benign	Het
Fah	A	C	7: 84,589,628	N336K	probably damaging	Het
Fam71e1	CCTGGGTCTGAGGGAGGA	CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA	7: 44,500,520		probably null	Het
Fbxo11	A	T	17: 87,996,053	I664K		Het
Fcgbp	A	G	7: 28,089,755	D582G	probably benign	Het
Gabre	C	CCGGCTA	X: 72,270,057		probably null	Het
Gm1110	A	G	9: 26,920,640	Y72H	probably damaging	Het
Gm14025	A	G	2: 129,038,794	F404S		Het
Inpp5e	C	T	2: 26,408,377	A71T	possibly damaging	Het
Iqcm	C	T	8: 75,577,899	T96I	probably benign	Het
Lce1m	TGCCACCGCTGC	TGCCACCGCTGCCGCCACCGCTGC	3: 93,018,283		probably benign	Het
Lce1m	AC	ACCGCCGCTGCCCC	3: 93,018,299		probably benign	Het
Lrch1	TTGGTGGTGCTGGTGG	TTGGTGG	14: 74,947,574		probably benign	Het
Lyst	A	G	13: 13,634,363	D206G	probably benign	Het
Map4k5	A	T	12: 69,856,856	D58E	probably damaging	Het
Mapkapk2	A	G	1: 131,056,513	S251P	probably damaging	Het
Mcph1	CCTG	CCTGCTG	8: 18,652,529		probably benign	Het
Men1	T	C	19: 6,340,116	S600P	probably damaging	Het
Mllt1	C	T	17: 56,896,300	V394M	probably benign	Het
Mllt1	C	A	17: 56,896,301	M393I	possibly damaging	Het
Nacc1	T	C	8: 84,676,219	E315G	possibly damaging	Het
Nefh	GGGGACTTGGCCTC	GGGGACTTGGCCTCACCTAGGGACTTGGCCTC	11: 4,941,047		probably benign	Het
Nefh	GACTTGGCCTC	GACTTGGCCTCACCTGGGGACTTGGCCTC	11: 4,941,050		probably benign	Het
Nid2	TAACACCGCCA	TA	14: 19,751,366		probably benign	Het
Olfr1484	T	A	19: 13,586,051	I206N	probably damaging	Het
Parp2	A	G	14: 50,817,386	E262G	probably damaging	Het
Pdik1l	TTT	TTTGTTTTTGTGTT	4: 134,279,375		probably null	Het
Pop1	G	A	15: 34,502,437	G90D	probably damaging	Het
Ppp3cc	T	C	14: 70,267,339	T73A	possibly damaging	Het
Prdm15	C	T	16: 97,799,629	D810N	probably damaging	Het
Prpf4b	T	A	13: 34,884,236	S349R	unknown	Het
Rassf6	TCCTGTAGAGCAATGGGGATTC	TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC	5: 90,608,921		probably benign	Het
Rassf6	GTAGAGCAATGGGGATTC	GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC	5: 90,608,925		probably null	Het
Sdk2	T	C	11: 113,885,252	E208G	probably benign	Het
Smurf2	G	T	11: 106,852,587	P211Q	probably benign	Het
Snx25	C	A	8: 46,116,181		probably null	Het
Spata6	T	A	4: 111,828,305	M469K	probably benign	Het
Spta1	G	T	1: 174,231,360	A1954S	possibly damaging	Het
Sry	CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG	CTGGTCATGGAACTGCTG	Y: 2,662,564		probably benign	Het
Stard8	GAG	GAGTAG	X: 99,066,515		probably null	Het
Tfeb	AGC	AGCGGC	17: 47,786,102		probably benign	Het
Tlcd1	T	A	11: 78,180,194	L203Q	probably benign	Het
Tlr11	T	C	14: 50,361,225	F223L	possibly damaging	Het
Usp48	T	A	4: 137,605,795	V100D	probably damaging	Het
Vmn2r56	G	A	7: 12,694,830	T503I	probably benign	Het
Vps18	T	C	2: 119,297,390	L898P	probably damaging	Het
Zfp384	GCCCAGGCCCAGGCCCAGGCCCAG	GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG	6: 125,036,471		probably benign	Het
Zfp706	T	A	15: 37,003,705	Y39F	probably benign	Het
Zhx3	T	A	2: 160,781,806	N147I	probably damaging	Het

Other mutations in Cd109

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Cd109	APN	9	78616969	missense	probably damaging	1.00
IGL00465:Cd109	APN	9	78660934	nonsense	probably null
IGL00667:Cd109	APN	9	78684877	missense	probably damaging	0.99
IGL01432:Cd109	APN	9	78698123	missense	probably benign
IGL01795:Cd109	APN	9	78661765	splice site	probably benign
IGL02343:Cd109	APN	9	78688955	splice site	probably benign
IGL02450:Cd109	APN	9	78695850	missense	possibly damaging	0.83
IGL02699:Cd109	APN	9	78671989	splice site	probably benign
IGL02738:Cd109	APN	9	78691299	missense	probably damaging	1.00
IGL02797:Cd109	APN	9	78661713	missense	probably damaging	0.96
IGL03160:Cd109	APN	9	78661056	splice site	probably null
IGL03349:Cd109	APN	9	78636485	missense	probably benign	0.34
FR4589:Cd109	UTSW	9	78712529	critical splice acceptor site	probably benign
R0048:Cd109	UTSW	9	78680021	missense	possibly damaging	0.50
R0060:Cd109	UTSW	9	78703107	missense	probably damaging	1.00
R0060:Cd109	UTSW	9	78703107	missense	probably damaging	1.00
R0158:Cd109	UTSW	9	78688932	missense	possibly damaging	0.49
R0415:Cd109	UTSW	9	78712615	missense	probably benign	0.13
R0659:Cd109	UTSW	9	78680170	splice site	probably benign
R0709:Cd109	UTSW	9	78671978	missense	possibly damaging	0.93
R0840:Cd109	UTSW	9	78664330	missense	probably benign	0.04
R0909:Cd109	UTSW	9	78636473	missense	probably benign	0.01
R0945:Cd109	UTSW	9	78688941	missense	possibly damaging	0.51
R1344:Cd109	UTSW	9	78672550	critical splice acceptor site	probably null
R1471:Cd109	UTSW	9	78654587	missense	probably damaging	1.00
R1484:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R1570:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R1688:Cd109	UTSW	9	78705091	missense	probably benign	0.17
R1773:Cd109	UTSW	9	78703724	missense	probably benign	0.21
R1813:Cd109	UTSW	9	78617005	missense	probably benign	0.04
R2004:Cd109	UTSW	9	78703762	missense	probably benign	0.00
R2083:Cd109	UTSW	9	78667293	missense	probably damaging	1.00
R2483:Cd109	UTSW	9	78667357	missense	probably damaging	1.00
R2857:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2858:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2859:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2911:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2912:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2914:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2927:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3623:Cd109	UTSW	9	78667357	missense	probably damaging	1.00
R3713:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3760:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3762:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3771:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3772:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3773:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3916:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3917:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4117:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4260:Cd109	UTSW	9	78636463	missense	possibly damaging	0.67
R4387:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4389:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4526:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4527:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4528:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4700:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4708:Cd109	UTSW	9	78672589	missense	probably benign	0.00
R4723:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4750:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4751:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4754:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4755:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4773:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4984:Cd109	UTSW	9	78634677	critical splice donor site	probably null
R5259:Cd109	UTSW	9	78710152	missense	probably benign	0.30
R5353:Cd109	UTSW	9	78710239	missense	probably damaging	1.00
R5440:Cd109	UTSW	9	78680164	critical splice donor site	probably null
R5559:Cd109	UTSW	9	78660968	missense	probably benign	0.01
R5701:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R5995:Cd109	UTSW	9	78700279	missense	probably benign	0.01
R5997:Cd109	UTSW	9	78705062	missense	possibly damaging	0.93
R6103:Cd109	UTSW	9	78698314	splice site	probably null
R6174:Cd109	UTSW	9	78665546	critical splice donor site	probably null
R6410:Cd109	UTSW	9	78657516	missense	probably benign	0.01
R6529:Cd109	UTSW	9	78712625	missense	probably damaging	1.00
R6655:Cd109	UTSW	9	78684938	missense	probably benign	0.44
R6704:Cd109	UTSW	9	78680075	missense	probably benign	0.01
R6772:Cd109	UTSW	9	78680810	missense	possibly damaging	0.55
R6817:Cd109	UTSW	9	78714955	missense	probably benign	0.01
R6903:Cd109	UTSW	9	78636603	missense	probably damaging	0.97
R7294:Cd109	UTSW	9	78712635	missense	probably damaging	0.97
R7432:Cd109	UTSW	9	78714943	missense	possibly damaging	0.85
R7566:Cd109	UTSW	9	78680837	missense	probably damaging	1.00
R7767:Cd109	UTSW	9	78710159	missense	probably damaging	1.00
R7986:Cd109	UTSW	9	78688766	missense	possibly damaging	0.95
R8017:Cd109	UTSW	9	78707546	missense	possibly damaging	0.81
R8019:Cd109	UTSW	9	78707546	missense	possibly damaging	0.81
R8050:Cd109	UTSW	9	78664351	missense	probably benign	0.28
R8225:Cd109	UTSW	9	78661690	missense	probably damaging	0.99
R8269:Cd109	UTSW	9	78665682	missense	probably benign	0.06
R8479:Cd109	UTSW	9	78667346	nonsense	probably null
R8493:Cd109	UTSW	9	78657519	missense	probably benign	0.41
R8781:Cd109	UTSW	9	78636647	missense	probably damaging	1.00
R8977:Cd109	UTSW	9	78707528	missense	probably benign	0.36
R9051:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R9051:Cd109	UTSW	9	78712531	critical splice acceptor site	probably benign
R9228:Cd109	UTSW	9	78669760	missense	possibly damaging	0.93
R9366:Cd109	UTSW	9	78714993	missense	probably benign	0.11
R9430:Cd109	UTSW	9	78667416	critical splice donor site	probably null
R9572:Cd109	UTSW	9	78660306	missense	probably benign	0.16
R9691:Cd109	UTSW	9	78703792	missense	possibly damaging	0.94
R9736:Cd109	UTSW	9	78712636	missense	probably damaging	1.00
R9749:Cd109	UTSW	9	78684884	missense	probably damaging	1.00
R9751:Cd109	UTSW	9	78698160	missense	probably damaging	0.99
R9752:Cd109	UTSW	9	78707552	missense	probably benign	0.00
R9789:Cd109	UTSW	9	78634662	missense	possibly damaging	0.90
R9797:Cd109	UTSW	9	78671935	missense	probably benign	0.04
RF002:Cd109	UTSW	9	78712523	critical splice acceptor site	probably benign
RF003:Cd109	UTSW	9	78712531	critical splice acceptor site	probably benign
RF011:Cd109	UTSW	9	78712528	critical splice acceptor site	probably benign
RF013:Cd109	UTSW	9	78712531	critical splice acceptor site	probably benign
RF047:Cd109	UTSW	9	78712527	critical splice acceptor site	probably benign
RF060:Cd109	UTSW	9	78712525	critical splice acceptor site	probably benign
Z1177:Cd109	UTSW	9	78691313	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TCCCTTTAGTAGACGGGGAC -3'
(R):5'- AATGAGTAAAATGCCTGCCTTG -3'

Sequencing Primer
(F):5'- GGGGACTAAGAACCATTCCTCTG -3'
(R):5'- GAGTAAAATGCCTGCCTTGATTCC -3'

Posted On

2019-12-04