Incidental Mutation 'RF002:Tlcd1'
ID 602572
Institutional Source Beutler Lab
Gene Symbol Tlcd1
Ensembl Gene ENSMUSG00000019437
Gene Name TLC domain containing 1
Synonyms 0610030G03Rik, 0610007A15Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock # RF002 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 78176711-78181909 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 78180194 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 203 (L203Q)
Ref Sequence ENSEMBL: ENSMUSP00000114202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017549] [ENSMUST00000092880] [ENSMUST00000098545] [ENSMUST00000102483] [ENSMUST00000108338] [ENSMUST00000127587] [ENSMUST00000147819] [ENSMUST00000148154]
AlphaFold Q99JT6
Predicted Effect probably benign
Transcript: ENSMUST00000017549
SMART Domains Protein: ENSMUSP00000017549
Gene: ENSMUSG00000017405

DomainStartEndE-ValueType
S_TKc 4 258 1.59e-81 SMART
low complexity region 288 316 N/A INTRINSIC
low complexity region 364 378 N/A INTRINSIC
Pfam:RCC1 415 464 4.1e-12 PFAM
Pfam:RCC1_2 451 480 9.2e-10 PFAM
Pfam:RCC1 467 516 9.9e-16 PFAM
Pfam:RCC1 585 634 4.4e-15 PFAM
Pfam:RCC1 637 687 2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092880
AA Change: L186Q

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000090556
Gene: ENSMUSG00000019437
AA Change: L186Q

DomainStartEndE-ValueType
TLC 28 217 1.19e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098545
AA Change: L176Q

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000096145
Gene: ENSMUSG00000019437
AA Change: L176Q

DomainStartEndE-ValueType
TLC 40 207 5.98e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102483
SMART Domains Protein: ENSMUSP00000099541
Gene: ENSMUSG00000058546

DomainStartEndE-ValueType
Pfam:Ribosomal_L23eN 15 68 9.7e-26 PFAM
Pfam:Ribosomal_L23 74 153 1.8e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108338
SMART Domains Protein: ENSMUSP00000103975
Gene: ENSMUSG00000019437

DomainStartEndE-ValueType
Pfam:TRAM_LAG1_CLN8 44 122 3.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127587
AA Change: L203Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000114202
Gene: ENSMUSG00000019437
AA Change: L203Q

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
TLC 40 234 1.41e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147819
SMART Domains Protein: ENSMUSP00000126593
Gene: ENSMUSG00000019437

DomainStartEndE-ValueType
Pfam:TRAM_LAG1_CLN8 33 103 4.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148154
SMART Domains Protein: ENSMUSP00000127554
Gene: ENSMUSG00000017405

DomainStartEndE-ValueType
Pfam:Pkinase 1 103 4.1e-20 PFAM
Pfam:Pkinase_Tyr 1 103 3.2e-12 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,235 probably benign Het
Angptl1 A T 1: 156,857,224 Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 51,805,593 probably null Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably benign Het
Blm CTC CTCATCCTCCTCATC 7: 80,512,927 probably benign Het
Car13 T C 3: 14,654,914 Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,712,523 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cdh26 T C 2: 178,466,631 C341R probably damaging Het
Chga GCA GCACCA 12: 102,561,421 probably benign Het
Col11a1 A T 3: 114,217,001 I1689L unknown Het
Dnah6 T G 6: 73,101,889 S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,455,186 probably benign Het
Fah A C 7: 84,589,628 N336K probably damaging Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Fbxo11 A T 17: 87,996,053 I664K Het
Fcgbp A G 7: 28,089,755 D582G probably benign Het
Gabre C CCGGCTA X: 72,270,057 probably null Het
Gm1110 A G 9: 26,920,640 Y72H probably damaging Het
Gm14025 A G 2: 129,038,794 F404S Het
Inpp5e C T 2: 26,408,377 A71T possibly damaging Het
Iqcm C T 8: 75,577,899 T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 93,018,283 probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 93,018,299 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lyst A G 13: 13,634,363 D206G probably benign Het
Map4k5 A T 12: 69,856,856 D58E probably damaging Het
Mapkapk2 A G 1: 131,056,513 S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,652,529 probably benign Het
Men1 T C 19: 6,340,116 S600P probably damaging Het
Mllt1 C T 17: 56,896,300 V394M probably benign Het
Mllt1 C A 17: 56,896,301 M393I possibly damaging Het
Nacc1 T C 8: 84,676,219 E315G possibly damaging Het
Nefh GGGGACTTGGCCTC GGGGACTTGGCCTCACCTAGGGACTTGGCCTC 11: 4,941,047 probably benign Het
Nefh GACTTGGCCTC GACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,050 probably benign Het
Nid2 TAACACCGCCA TA 14: 19,751,366 probably benign Het
Olfr1484 T A 19: 13,586,051 I206N probably damaging Het
Parp2 A G 14: 50,817,386 E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,279,375 probably null Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Ppp3cc T C 14: 70,267,339 T73A possibly damaging Het
Prdm15 C T 16: 97,799,629 D810N probably damaging Het
Prpf4b T A 13: 34,884,236 S349R unknown Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,608,921 probably benign Het
Rassf6 GTAGAGCAATGGGGATTC GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC 5: 90,608,925 probably null Het
Sdk2 T C 11: 113,885,252 E208G probably benign Het
Smurf2 G T 11: 106,852,587 P211Q probably benign Het
Snx25 C A 8: 46,116,181 probably null Het
Spata6 T A 4: 111,828,305 M469K probably benign Het
Spta1 G T 1: 174,231,360 A1954S possibly damaging Het
Sry CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG CTGGTCATGGAACTGCTG Y: 2,662,564 probably benign Het
Stard8 GAG GAGTAG X: 99,066,515 probably null Het
Tfeb AGC AGCGGC 17: 47,786,102 probably benign Het
Tlr11 T C 14: 50,361,225 F223L possibly damaging Het
Usp48 T A 4: 137,605,795 V100D probably damaging Het
Vmn2r56 G A 7: 12,694,830 T503I probably benign Het
Vps18 T C 2: 119,297,390 L898P probably damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp706 T A 15: 37,003,705 Y39F probably benign Het
Zhx3 T A 2: 160,781,806 N147I probably damaging Het
Other mutations in Tlcd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Tlcd1 APN 11 78180088 missense probably damaging 1.00
IGL01014:Tlcd1 APN 11 78179457 splice site probably null
IGL01797:Tlcd1 APN 11 78180334 splice site probably null
IGL02303:Tlcd1 APN 11 78180334 splice site probably null
IGL02638:Tlcd1 APN 11 78179618 missense probably benign 0.18
IGL02685:Tlcd1 APN 11 78179537 unclassified probably benign
R2446:Tlcd1 UTSW 11 78178797 unclassified probably benign
R5583:Tlcd1 UTSW 11 78178936 missense probably benign 0.05
R8712:Tlcd1 UTSW 11 78179644 makesense probably null
Predicted Primers PCR Primer
(F):5'- TGGTAGAGGTCAGCAACATCTTC -3'
(R):5'- CAAGCTTGGGGCAGAGTACTAG -3'

Sequencing Primer
(F):5'- CCTCACCTTAAGGATGATGATGAAG -3'
(R):5'- GGCAGAGTACTAGTTTATGTTACAG -3'
Posted On 2019-12-04