Incidental Mutation 'RF002:Sdk2'
ID 602574
Institutional Source Beutler Lab
Gene Symbol Sdk2
Ensembl Gene ENSMUSG00000041592
Gene Name sidekick cell adhesion molecule 2
Synonyms 4632412F08Rik, 5330435L01Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # RF002 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 113667200-113957855 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 113776078 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 208 (E208G)
Ref Sequence ENSEMBL: ENSMUSP00000038972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041627] [ENSMUST00000141943]
AlphaFold Q6V4S5
Predicted Effect probably benign
Transcript: ENSMUST00000041627
AA Change: E208G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: E208G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 43 102 4.67e-4 SMART
IG 123 208 6.07e-3 SMART
IG 225 309 1.4e-7 SMART
IGc2 325 391 6.21e-9 SMART
IGc2 418 486 8.57e-12 SMART
IG 506 591 2.37e-5 SMART
FN3 594 678 1.91e-7 SMART
FN3 694 780 2.42e-9 SMART
FN3 796 884 3.45e-5 SMART
FN3 899 981 2.36e-12 SMART
FN3 997 1084 1.64e-6 SMART
FN3 1101 1188 8.83e-12 SMART
FN3 1204 1289 3.62e-8 SMART
FN3 1305 1388 1.74e-10 SMART
FN3 1404 1489 8.23e-12 SMART
FN3 1506 1612 3.62e-8 SMART
FN3 1628 1713 1.15e-10 SMART
FN3 1728 1815 2.17e-11 SMART
FN3 1829 1913 5.04e-7 SMART
transmembrane domain 1935 1957 N/A INTRINSIC
low complexity region 2138 2153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141943
AA Change: E208G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000116872
Gene: ENSMUSG00000041592
AA Change: E208G

DomainStartEndE-ValueType
IGc2 43 102 4.67e-4 SMART
IG 123 208 6.07e-3 SMART
IG 225 309 1.4e-7 SMART
IGc2 325 391 6.21e-9 SMART
IGc2 418 486 8.57e-12 SMART
IG 506 591 2.37e-5 SMART
FN3 594 678 1.91e-7 SMART
FN3 694 780 2.42e-9 SMART
FN3 796 889 1.96e1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,475,262 (GRCm39) probably benign Het
AI837181 GGC GGCTGC 19: 5,475,263 (GRCm39) probably benign Het
Angptl1 A T 1: 156,684,794 (GRCm39) Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 52,043,050 (GRCm39) probably null Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT 7: 80,162,653 (GRCm39) probably benign Het
Blm CTC CTCATCCTCCTCATC 7: 80,162,675 (GRCm39) probably benign Het
Car13 T C 3: 14,719,974 (GRCm39) Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,619,805 (GRCm39) probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,619,810 (GRCm39) probably benign Het
Cdh26 T C 2: 178,108,424 (GRCm39) C341R probably damaging Het
Chga GCA GCACCA 12: 102,527,680 (GRCm39) probably benign Het
Col11a1 A T 3: 114,010,650 (GRCm39) I1689L unknown Het
Dnah6 T G 6: 73,078,872 (GRCm39) S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,674,160 (GRCm39) probably benign Het
Fah A C 7: 84,238,836 (GRCm39) N336K probably damaging Het
Fbxo11 A T 17: 88,303,481 (GRCm39) I664K Het
Fcgbp A G 7: 27,789,180 (GRCm39) D582G probably benign Het
Gabre C CCGGCTA X: 71,313,663 (GRCm39) probably null Het
Garin5a CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA 7: 44,149,944 (GRCm39) probably null Het
Gm1110 A G 9: 26,831,936 (GRCm39) Y72H probably damaging Het
Inpp5e C T 2: 26,298,389 (GRCm39) A71T possibly damaging Het
Iqcm C T 8: 76,304,527 (GRCm39) T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 92,925,590 (GRCm39) probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 92,925,606 (GRCm39) probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 75,185,014 (GRCm39) probably benign Het
Lyst A G 13: 13,808,948 (GRCm39) D206G probably benign Het
Map4k5 A T 12: 69,903,630 (GRCm39) D58E probably damaging Het
Mapkapk2 A G 1: 130,984,250 (GRCm39) S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,702,545 (GRCm39) probably benign Het
Men1 T C 19: 6,390,146 (GRCm39) S600P probably damaging Het
Mllt1 C T 17: 57,203,300 (GRCm39) V394M probably benign Het
Mllt1 C A 17: 57,203,301 (GRCm39) M393I possibly damaging Het
Nacc1 T C 8: 85,402,848 (GRCm39) E315G possibly damaging Het
Nefh GGGGACTTGGCCTC GGGGACTTGGCCTCACCTAGGGACTTGGCCTC 11: 4,891,047 (GRCm39) probably benign Het
Nefh GACTTGGCCTC GACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,050 (GRCm39) probably benign Het
Nid2 TAACACCGCCA TA 14: 19,801,434 (GRCm39) probably benign Het
Or5b122 T A 19: 13,563,415 (GRCm39) I206N probably damaging Het
Parp2 A G 14: 51,054,843 (GRCm39) E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,006,686 (GRCm39) probably null Het
Pop1 G A 15: 34,502,583 (GRCm39) G90D probably damaging Het
Ppp3cc T C 14: 70,504,788 (GRCm39) T73A possibly damaging Het
Prdm15 C T 16: 97,600,829 (GRCm39) D810N probably damaging Het
Prpf4b T A 13: 35,068,219 (GRCm39) S349R unknown Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,756,780 (GRCm39) probably benign Het
Rassf6 GTAGAGCAATGGGGATTC GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC 5: 90,756,784 (GRCm39) probably null Het
Smurf2 G T 11: 106,743,413 (GRCm39) P211Q probably benign Het
Snx25 C A 8: 46,569,218 (GRCm39) probably null Het
Spata6 T A 4: 111,685,502 (GRCm39) M469K probably benign Het
Spta1 G T 1: 174,058,926 (GRCm39) A1954S possibly damaging Het
Sry CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG CTGGTCATGGAACTGCTG Y: 2,662,564 (GRCm39) probably benign Het
Stard8 GAG GAGTAG X: 98,110,121 (GRCm39) probably null Het
Tfeb AGC AGCGGC 17: 48,097,027 (GRCm39) probably benign Het
Tlcd1 T A 11: 78,071,020 (GRCm39) L203Q probably benign Het
Tlr11 T C 14: 50,598,682 (GRCm39) F223L possibly damaging Het
Usp48 T A 4: 137,333,106 (GRCm39) V100D probably damaging Het
Vinac1 A G 2: 128,880,714 (GRCm39) F404S Het
Vmn2r56 G A 7: 12,428,757 (GRCm39) T503I probably benign Het
Vps18 T C 2: 119,127,871 (GRCm39) L898P probably damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,013,434 (GRCm39) probably benign Het
Zfp706 T A 15: 37,003,949 (GRCm39) Y39F probably benign Het
Zhx3 T A 2: 160,623,726 (GRCm39) N147I probably damaging Het
Other mutations in Sdk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Sdk2 APN 11 113,745,210 (GRCm39) missense possibly damaging 0.86
IGL01063:Sdk2 APN 11 113,721,668 (GRCm39) missense probably damaging 1.00
IGL01291:Sdk2 APN 11 113,733,906 (GRCm39) missense probably benign
IGL01316:Sdk2 APN 11 113,758,791 (GRCm39) missense probably benign 0.09
IGL01614:Sdk2 APN 11 113,684,684 (GRCm39) missense probably damaging 1.00
IGL01998:Sdk2 APN 11 113,729,358 (GRCm39) missense probably damaging 0.98
IGL02014:Sdk2 APN 11 113,729,320 (GRCm39) missense probably damaging 1.00
IGL02095:Sdk2 APN 11 113,725,656 (GRCm39) missense probably damaging 1.00
IGL02115:Sdk2 APN 11 113,725,639 (GRCm39) splice site probably benign
IGL02543:Sdk2 APN 11 113,759,747 (GRCm39) missense possibly damaging 0.90
IGL02976:Sdk2 APN 11 113,742,668 (GRCm39) missense probably damaging 1.00
IGL03001:Sdk2 APN 11 113,712,452 (GRCm39) missense probably benign 0.00
IGL03122:Sdk2 APN 11 113,732,894 (GRCm39) missense probably damaging 1.00
IGL03183:Sdk2 APN 11 113,741,810 (GRCm39) missense probably benign 0.19
IGL03222:Sdk2 APN 11 113,729,257 (GRCm39) missense probably benign 0.01
IGL03310:Sdk2 APN 11 113,684,151 (GRCm39) missense possibly damaging 0.77
Curtailed UTSW 11 113,742,626 (GRCm39) missense probably damaging 1.00
Trimmed UTSW 11 113,747,522 (GRCm39) nonsense probably null
ANU05:Sdk2 UTSW 11 113,733,906 (GRCm39) missense probably benign
BB008:Sdk2 UTSW 11 113,784,267 (GRCm39) missense possibly damaging 0.79
BB018:Sdk2 UTSW 11 113,784,267 (GRCm39) missense possibly damaging 0.79
R0008:Sdk2 UTSW 11 113,747,581 (GRCm39) missense probably damaging 1.00
R0008:Sdk2 UTSW 11 113,747,581 (GRCm39) missense probably damaging 1.00
R0088:Sdk2 UTSW 11 113,717,912 (GRCm39) missense possibly damaging 0.74
R0096:Sdk2 UTSW 11 113,793,970 (GRCm39) splice site probably benign
R0386:Sdk2 UTSW 11 113,784,290 (GRCm39) missense probably damaging 0.96
R0396:Sdk2 UTSW 11 113,720,793 (GRCm39) missense probably benign 0.04
R0409:Sdk2 UTSW 11 113,741,717 (GRCm39) splice site probably benign
R0416:Sdk2 UTSW 11 113,694,029 (GRCm39) missense probably damaging 1.00
R0456:Sdk2 UTSW 11 113,682,292 (GRCm39) missense possibly damaging 0.93
R0544:Sdk2 UTSW 11 113,671,836 (GRCm39) missense probably damaging 1.00
R0691:Sdk2 UTSW 11 113,685,746 (GRCm39) splice site probably null
R0711:Sdk2 UTSW 11 113,793,970 (GRCm39) splice site probably benign
R0717:Sdk2 UTSW 11 113,723,152 (GRCm39) missense probably damaging 1.00
R0780:Sdk2 UTSW 11 113,784,334 (GRCm39) missense probably benign 0.07
R0831:Sdk2 UTSW 11 113,723,084 (GRCm39) missense probably damaging 0.96
R0853:Sdk2 UTSW 11 113,712,241 (GRCm39) missense probably benign 0.00
R0865:Sdk2 UTSW 11 113,741,748 (GRCm39) missense probably benign 0.12
R0930:Sdk2 UTSW 11 113,729,271 (GRCm39) missense probably benign 0.01
R0964:Sdk2 UTSW 11 113,697,243 (GRCm39) splice site probably benign
R1051:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1052:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1054:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1055:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1077:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1079:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1115:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1186:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1187:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1337:Sdk2 UTSW 11 113,723,157 (GRCm39) missense possibly damaging 0.79
R1430:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1433:Sdk2 UTSW 11 113,685,871 (GRCm39) missense probably damaging 0.99
R1464:Sdk2 UTSW 11 113,720,906 (GRCm39) missense possibly damaging 0.86
R1464:Sdk2 UTSW 11 113,720,906 (GRCm39) missense possibly damaging 0.86
R1497:Sdk2 UTSW 11 113,784,401 (GRCm39) splice site probably benign
R1514:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1529:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1596:Sdk2 UTSW 11 113,729,435 (GRCm39) splice site probably benign
R1680:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1680:Sdk2 UTSW 11 113,682,262 (GRCm39) missense possibly damaging 0.47
R1770:Sdk2 UTSW 11 113,684,567 (GRCm39) missense probably benign 0.05
R1858:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1866:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1874:Sdk2 UTSW 11 113,725,782 (GRCm39) missense probably benign 0.00
R1899:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1905:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1907:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1913:Sdk2 UTSW 11 113,747,552 (GRCm39) missense possibly damaging 0.77
R1964:Sdk2 UTSW 11 113,671,843 (GRCm39) nonsense probably null
R2055:Sdk2 UTSW 11 113,741,780 (GRCm39) missense probably damaging 1.00
R2059:Sdk2 UTSW 11 113,745,158 (GRCm39) missense probably damaging 1.00
R2093:Sdk2 UTSW 11 113,833,948 (GRCm39) missense probably damaging 1.00
R2256:Sdk2 UTSW 11 113,721,620 (GRCm39) missense probably benign 0.44
R3720:Sdk2 UTSW 11 113,691,070 (GRCm39) missense probably damaging 1.00
R3795:Sdk2 UTSW 11 113,747,522 (GRCm39) nonsense probably null
R4037:Sdk2 UTSW 11 113,685,881 (GRCm39) missense probably damaging 1.00
R4171:Sdk2 UTSW 11 113,757,815 (GRCm39) splice site probably null
R4717:Sdk2 UTSW 11 113,745,195 (GRCm39) missense probably damaging 0.96
R4758:Sdk2 UTSW 11 113,717,880 (GRCm39) missense possibly damaging 0.87
R4857:Sdk2 UTSW 11 113,712,208 (GRCm39) nonsense probably null
R4924:Sdk2 UTSW 11 113,748,584 (GRCm39) missense probably damaging 1.00
R5015:Sdk2 UTSW 11 113,684,587 (GRCm39) missense probably damaging 1.00
R5171:Sdk2 UTSW 11 113,741,808 (GRCm39) missense probably benign 0.01
R5239:Sdk2 UTSW 11 113,758,859 (GRCm39) missense probably damaging 1.00
R5243:Sdk2 UTSW 11 113,715,912 (GRCm39) missense possibly damaging 0.76
R5279:Sdk2 UTSW 11 113,757,857 (GRCm39) missense probably benign 0.31
R5535:Sdk2 UTSW 11 113,833,984 (GRCm39) missense possibly damaging 0.80
R5634:Sdk2 UTSW 11 113,742,540 (GRCm39) missense probably damaging 1.00
R5637:Sdk2 UTSW 11 113,724,005 (GRCm39) missense probably damaging 1.00
R5726:Sdk2 UTSW 11 113,742,626 (GRCm39) missense probably damaging 1.00
R5793:Sdk2 UTSW 11 113,759,778 (GRCm39) missense possibly damaging 0.46
R5798:Sdk2 UTSW 11 113,717,942 (GRCm39) missense probably damaging 1.00
R5834:Sdk2 UTSW 11 113,745,099 (GRCm39) missense probably damaging 1.00
R5863:Sdk2 UTSW 11 113,725,810 (GRCm39) missense probably damaging 0.98
R5869:Sdk2 UTSW 11 113,742,708 (GRCm39) missense probably damaging 0.96
R5875:Sdk2 UTSW 11 113,720,885 (GRCm39) missense probably benign 0.00
R5953:Sdk2 UTSW 11 113,684,570 (GRCm39) missense probably damaging 1.00
R5991:Sdk2 UTSW 11 113,834,080 (GRCm39) missense probably damaging 0.97
R6018:Sdk2 UTSW 11 113,720,889 (GRCm39) missense probably benign 0.00
R6116:Sdk2 UTSW 11 113,745,190 (GRCm39) missense probably damaging 0.99
R6328:Sdk2 UTSW 11 113,684,581 (GRCm39) missense probably damaging 1.00
R6348:Sdk2 UTSW 11 113,784,334 (GRCm39) missense probably benign 0.07
R6383:Sdk2 UTSW 11 113,723,091 (GRCm39) missense probably damaging 1.00
R6824:Sdk2 UTSW 11 113,758,760 (GRCm39) missense probably benign 0.43
R6835:Sdk2 UTSW 11 113,720,874 (GRCm39) missense probably damaging 0.98
R6853:Sdk2 UTSW 11 113,671,755 (GRCm39) missense probably damaging 0.99
R6912:Sdk2 UTSW 11 113,793,946 (GRCm39) missense probably benign 0.03
R7000:Sdk2 UTSW 11 113,693,995 (GRCm39) missense probably damaging 1.00
R7099:Sdk2 UTSW 11 113,725,731 (GRCm39) missense probably damaging 0.98
R7102:Sdk2 UTSW 11 113,733,516 (GRCm39) nonsense probably null
R7177:Sdk2 UTSW 11 113,720,795 (GRCm39) missense possibly damaging 0.91
R7381:Sdk2 UTSW 11 113,729,315 (GRCm39) missense probably damaging 0.98
R7412:Sdk2 UTSW 11 113,758,909 (GRCm39) splice site probably null
R7504:Sdk2 UTSW 11 113,758,793 (GRCm39) missense possibly damaging 0.50
R7552:Sdk2 UTSW 11 113,764,039 (GRCm39) missense possibly damaging 0.63
R7604:Sdk2 UTSW 11 113,720,795 (GRCm39) missense possibly damaging 0.91
R7647:Sdk2 UTSW 11 113,684,563 (GRCm39) missense probably damaging 1.00
R7897:Sdk2 UTSW 11 113,764,027 (GRCm39) missense possibly damaging 0.50
R7931:Sdk2 UTSW 11 113,784,267 (GRCm39) missense possibly damaging 0.79
R7998:Sdk2 UTSW 11 113,750,764 (GRCm39) missense probably benign 0.18
R8052:Sdk2 UTSW 11 113,745,177 (GRCm39) missense probably damaging 1.00
R8053:Sdk2 UTSW 11 113,745,177 (GRCm39) missense probably damaging 1.00
R8084:Sdk2 UTSW 11 113,717,915 (GRCm39) missense possibly damaging 0.67
R8136:Sdk2 UTSW 11 113,742,539 (GRCm39) missense probably damaging 1.00
R8151:Sdk2 UTSW 11 113,763,683 (GRCm39) missense possibly damaging 0.84
R8394:Sdk2 UTSW 11 113,729,542 (GRCm39) missense probably benign
R8715:Sdk2 UTSW 11 113,671,728 (GRCm39) missense probably damaging 1.00
R8774:Sdk2 UTSW 11 113,730,169 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Sdk2 UTSW 11 113,730,169 (GRCm39) missense probably damaging 1.00
R8804:Sdk2 UTSW 11 113,763,978 (GRCm39) nonsense probably null
R9136:Sdk2 UTSW 11 113,697,203 (GRCm39) missense probably damaging 1.00
R9147:Sdk2 UTSW 11 113,714,226 (GRCm39) missense probably benign 0.18
R9300:Sdk2 UTSW 11 113,715,856 (GRCm39) missense possibly damaging 0.63
R9354:Sdk2 UTSW 11 113,725,757 (GRCm39) missense probably benign 0.00
R9450:Sdk2 UTSW 11 113,697,105 (GRCm39) missense probably benign
R9462:Sdk2 UTSW 11 113,760,744 (GRCm39) missense possibly damaging 0.56
R9616:Sdk2 UTSW 11 113,691,061 (GRCm39) missense probably benign 0.05
R9678:Sdk2 UTSW 11 113,685,789 (GRCm39) nonsense probably null
V1662:Sdk2 UTSW 11 113,725,734 (GRCm39) missense probably damaging 1.00
Z1176:Sdk2 UTSW 11 113,742,662 (GRCm39) missense probably damaging 0.97
Z1176:Sdk2 UTSW 11 113,730,148 (GRCm39) missense probably benign 0.41
Z1177:Sdk2 UTSW 11 113,750,782 (GRCm39) missense probably benign
Z1177:Sdk2 UTSW 11 113,730,146 (GRCm39) missense probably damaging 1.00
Z1177:Sdk2 UTSW 11 113,729,485 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACATTCACTGGCTTCCCCAAC -3'
(R):5'- TCACACAGTCTGCCTGCAAG -3'

Sequencing Primer
(F):5'- AACCTTGTCCCCCTACTCAGG -3'
(R):5'- TGCCTGCAAGACCTTTGG -3'
Posted On 2019-12-04