Incidental Mutation 'RF002:Prpf4b'
ID 602578
Institutional Source Beutler Lab
Gene Symbol Prpf4b
Ensembl Gene ENSMUSG00000021413
Gene Name pre-mRNA processing factor 4B
Synonyms Prpk, Prp4k, Prp4
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF002 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 35059285-35090047 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 35068219 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 349 (S349R)
Ref Sequence ENSEMBL: ENSMUSP00000077019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077853] [ENSMUST00000222509]
AlphaFold Q61136
Predicted Effect unknown
Transcript: ENSMUST00000077853
AA Change: S349R
SMART Domains Protein: ENSMUSP00000077019
Gene: ENSMUSG00000021413
AA Change: S349R

DomainStartEndE-ValueType
low complexity region 40 62 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
coiled coil region 102 123 N/A INTRINSIC
low complexity region 142 150 N/A INTRINSIC
low complexity region 156 170 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
low complexity region 210 233 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
low complexity region 284 294 N/A INTRINSIC
low complexity region 299 324 N/A INTRINSIC
low complexity region 340 360 N/A INTRINSIC
low complexity region 390 417 N/A INTRINSIC
low complexity region 435 497 N/A INTRINSIC
low complexity region 521 535 N/A INTRINSIC
low complexity region 562 581 N/A INTRINSIC
S_TKc 687 1003 4.99e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220965
Predicted Effect unknown
Transcript: ENSMUST00000222509
AA Change: S349R
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in two sequential transesterification steps, and the protein encoded by this gene is thought to be involved in pre-mRNA splicing and in signal transduction. This protein belongs to a kinase family that includes serine/arginine-rich protein-specific kinases and cyclin-dependent kinases (CDKs). This protein is regarded as a CDK-like kinase (Clk) with homology to mitogen-activated protein kinases (MAPKs). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,475,262 (GRCm39) probably benign Het
AI837181 GGC GGCTGC 19: 5,475,263 (GRCm39) probably benign Het
Angptl1 A T 1: 156,684,794 (GRCm39) Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 52,043,050 (GRCm39) probably null Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT 7: 80,162,653 (GRCm39) probably benign Het
Blm CTC CTCATCCTCCTCATC 7: 80,162,675 (GRCm39) probably benign Het
Car13 T C 3: 14,719,974 (GRCm39) Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,619,805 (GRCm39) probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,619,810 (GRCm39) probably benign Het
Cdh26 T C 2: 178,108,424 (GRCm39) C341R probably damaging Het
Chga GCA GCACCA 12: 102,527,680 (GRCm39) probably benign Het
Col11a1 A T 3: 114,010,650 (GRCm39) I1689L unknown Het
Dnah6 T G 6: 73,078,872 (GRCm39) S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,674,160 (GRCm39) probably benign Het
Fah A C 7: 84,238,836 (GRCm39) N336K probably damaging Het
Fbxo11 A T 17: 88,303,481 (GRCm39) I664K Het
Fcgbp A G 7: 27,789,180 (GRCm39) D582G probably benign Het
Gabre C CCGGCTA X: 71,313,663 (GRCm39) probably null Het
Garin5a CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA 7: 44,149,944 (GRCm39) probably null Het
Gm1110 A G 9: 26,831,936 (GRCm39) Y72H probably damaging Het
Inpp5e C T 2: 26,298,389 (GRCm39) A71T possibly damaging Het
Iqcm C T 8: 76,304,527 (GRCm39) T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 92,925,590 (GRCm39) probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 92,925,606 (GRCm39) probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 75,185,014 (GRCm39) probably benign Het
Lyst A G 13: 13,808,948 (GRCm39) D206G probably benign Het
Map4k5 A T 12: 69,903,630 (GRCm39) D58E probably damaging Het
Mapkapk2 A G 1: 130,984,250 (GRCm39) S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,702,545 (GRCm39) probably benign Het
Men1 T C 19: 6,390,146 (GRCm39) S600P probably damaging Het
Mllt1 C T 17: 57,203,300 (GRCm39) V394M probably benign Het
Mllt1 C A 17: 57,203,301 (GRCm39) M393I possibly damaging Het
Nacc1 T C 8: 85,402,848 (GRCm39) E315G possibly damaging Het
Nefh GGGGACTTGGCCTC GGGGACTTGGCCTCACCTAGGGACTTGGCCTC 11: 4,891,047 (GRCm39) probably benign Het
Nefh GACTTGGCCTC GACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,050 (GRCm39) probably benign Het
Nid2 TAACACCGCCA TA 14: 19,801,434 (GRCm39) probably benign Het
Or5b122 T A 19: 13,563,415 (GRCm39) I206N probably damaging Het
Parp2 A G 14: 51,054,843 (GRCm39) E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,006,686 (GRCm39) probably null Het
Pop1 G A 15: 34,502,583 (GRCm39) G90D probably damaging Het
Ppp3cc T C 14: 70,504,788 (GRCm39) T73A possibly damaging Het
Prdm15 C T 16: 97,600,829 (GRCm39) D810N probably damaging Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,756,780 (GRCm39) probably benign Het
Rassf6 GTAGAGCAATGGGGATTC GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC 5: 90,756,784 (GRCm39) probably null Het
Sdk2 T C 11: 113,776,078 (GRCm39) E208G probably benign Het
Smurf2 G T 11: 106,743,413 (GRCm39) P211Q probably benign Het
Snx25 C A 8: 46,569,218 (GRCm39) probably null Het
Spata6 T A 4: 111,685,502 (GRCm39) M469K probably benign Het
Spta1 G T 1: 174,058,926 (GRCm39) A1954S possibly damaging Het
Sry CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG CTGGTCATGGAACTGCTG Y: 2,662,564 (GRCm39) probably benign Het
Stard8 GAG GAGTAG X: 98,110,121 (GRCm39) probably null Het
Tfeb AGC AGCGGC 17: 48,097,027 (GRCm39) probably benign Het
Tlcd1 T A 11: 78,071,020 (GRCm39) L203Q probably benign Het
Tlr11 T C 14: 50,598,682 (GRCm39) F223L possibly damaging Het
Usp48 T A 4: 137,333,106 (GRCm39) V100D probably damaging Het
Vinac1 A G 2: 128,880,714 (GRCm39) F404S Het
Vmn2r56 G A 7: 12,428,757 (GRCm39) T503I probably benign Het
Vps18 T C 2: 119,127,871 (GRCm39) L898P probably damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,013,434 (GRCm39) probably benign Het
Zfp706 T A 15: 37,003,949 (GRCm39) Y39F probably benign Het
Zhx3 T A 2: 160,623,726 (GRCm39) N147I probably damaging Het
Other mutations in Prpf4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Prpf4b APN 13 35,067,890 (GRCm39) missense probably benign 0.23
IGL00639:Prpf4b APN 13 35,083,156 (GRCm39) missense possibly damaging 0.70
IGL00901:Prpf4b APN 13 35,078,465 (GRCm39) missense probably damaging 1.00
IGL01301:Prpf4b APN 13 35,068,274 (GRCm39) missense probably benign 0.23
IGL02027:Prpf4b APN 13 35,073,554 (GRCm39) missense probably benign 0.35
IGL02111:Prpf4b APN 13 35,067,944 (GRCm39) missense probably benign 0.23
IGL02256:Prpf4b APN 13 35,083,861 (GRCm39) missense probably damaging 0.98
IGL02590:Prpf4b APN 13 35,072,129 (GRCm39) unclassified probably benign
IGL03389:Prpf4b APN 13 35,084,439 (GRCm39) splice site probably benign
IGL03411:Prpf4b APN 13 35,079,342 (GRCm39) missense probably damaging 1.00
ANU18:Prpf4b UTSW 13 35,068,274 (GRCm39) missense probably benign 0.23
PIT4260001:Prpf4b UTSW 13 35,068,274 (GRCm39) missense probably benign 0.23
PIT4696001:Prpf4b UTSW 13 35,083,825 (GRCm39) missense probably benign 0.01
R0114:Prpf4b UTSW 13 35,074,471 (GRCm39) splice site probably benign
R0157:Prpf4b UTSW 13 35,068,014 (GRCm39) unclassified probably benign
R1551:Prpf4b UTSW 13 35,078,426 (GRCm39) missense possibly damaging 0.91
R1587:Prpf4b UTSW 13 35,076,133 (GRCm39) missense probably benign 0.09
R2105:Prpf4b UTSW 13 35,068,214 (GRCm39) unclassified probably benign
R2152:Prpf4b UTSW 13 35,084,402 (GRCm39) missense probably benign 0.04
R2432:Prpf4b UTSW 13 35,067,324 (GRCm39) unclassified probably benign
R3802:Prpf4b UTSW 13 35,067,665 (GRCm39) unclassified probably benign
R3803:Prpf4b UTSW 13 35,067,665 (GRCm39) unclassified probably benign
R3804:Prpf4b UTSW 13 35,067,665 (GRCm39) unclassified probably benign
R3982:Prpf4b UTSW 13 35,068,196 (GRCm39) unclassified probably benign
R4603:Prpf4b UTSW 13 35,072,147 (GRCm39) unclassified probably benign
R4633:Prpf4b UTSW 13 35,084,425 (GRCm39) missense probably damaging 1.00
R4649:Prpf4b UTSW 13 35,083,954 (GRCm39) missense probably benign 0.06
R4651:Prpf4b UTSW 13 35,083,954 (GRCm39) missense probably benign 0.06
R4653:Prpf4b UTSW 13 35,083,954 (GRCm39) missense probably benign 0.06
R5022:Prpf4b UTSW 13 35,067,582 (GRCm39) unclassified probably benign
R5028:Prpf4b UTSW 13 35,083,958 (GRCm39) missense probably damaging 1.00
R5232:Prpf4b UTSW 13 35,067,573 (GRCm39) unclassified probably benign
R5313:Prpf4b UTSW 13 35,078,532 (GRCm39) missense probably damaging 1.00
R5440:Prpf4b UTSW 13 35,068,076 (GRCm39) unclassified probably benign
R5511:Prpf4b UTSW 13 35,068,037 (GRCm39) unclassified probably benign
R5863:Prpf4b UTSW 13 35,083,111 (GRCm39) missense possibly damaging 0.51
R5981:Prpf4b UTSW 13 35,070,693 (GRCm39) missense probably benign 0.23
R6360:Prpf4b UTSW 13 35,085,416 (GRCm39) missense probably damaging 0.99
R6398:Prpf4b UTSW 13 35,084,354 (GRCm39) missense probably damaging 1.00
R6556:Prpf4b UTSW 13 35,080,015 (GRCm39) missense probably damaging 0.98
R6880:Prpf4b UTSW 13 35,078,436 (GRCm39) missense possibly damaging 0.69
R7133:Prpf4b UTSW 13 35,085,477 (GRCm39) missense probably benign 0.02
R7148:Prpf4b UTSW 13 35,078,455 (GRCm39) missense probably benign 0.04
R7208:Prpf4b UTSW 13 35,067,994 (GRCm39) missense unknown
R7966:Prpf4b UTSW 13 35,085,428 (GRCm39) missense probably damaging 0.96
R8241:Prpf4b UTSW 13 35,079,974 (GRCm39) missense probably damaging 1.00
R8298:Prpf4b UTSW 13 35,072,166 (GRCm39) missense unknown
R9609:Prpf4b UTSW 13 35,068,032 (GRCm39) missense unknown
R9710:Prpf4b UTSW 13 35,083,870 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCAATTGTAAATGAAAGGAGTCG -3'
(R):5'- GAAGAAAGTCGTCTCCTCTCTGG -3'

Sequencing Primer
(F):5'- GTAAATGAAAGGAGTCGAGATAGATC -3'
(R):5'- GAAAGTCGTCTCCTCTCTGGTTCTC -3'
Posted On 2019-12-04