Incidental Mutation 'RF002:Prpf4b'
Institutional Source Beutler Lab
Gene Symbol Prpf4b
Ensembl Gene ENSMUSG00000021413
Gene Namepre-mRNA processing factor 4B
SynonymsPrp4, Prp4k, Prpk
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF002 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location34875302-34906064 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34884236 bp
Amino Acid Change Serine to Arginine at position 349 (S349R)
Ref Sequence ENSEMBL: ENSMUSP00000077019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077853] [ENSMUST00000222509]
Predicted Effect unknown
Transcript: ENSMUST00000077853
AA Change: S349R
SMART Domains Protein: ENSMUSP00000077019
Gene: ENSMUSG00000021413
AA Change: S349R

low complexity region 40 62 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
coiled coil region 102 123 N/A INTRINSIC
low complexity region 142 150 N/A INTRINSIC
low complexity region 156 170 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
low complexity region 210 233 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
low complexity region 284 294 N/A INTRINSIC
low complexity region 299 324 N/A INTRINSIC
low complexity region 340 360 N/A INTRINSIC
low complexity region 390 417 N/A INTRINSIC
low complexity region 435 497 N/A INTRINSIC
low complexity region 521 535 N/A INTRINSIC
low complexity region 562 581 N/A INTRINSIC
S_TKc 687 1003 4.99e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220965
Predicted Effect unknown
Transcript: ENSMUST00000222509
AA Change: S349R
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in two sequential transesterification steps, and the protein encoded by this gene is thought to be involved in pre-mRNA splicing and in signal transduction. This protein belongs to a kinase family that includes serine/arginine-rich protein-specific kinases and cyclin-dependent kinases (CDKs). This protein is regarded as a CDK-like kinase (Clk) with homology to mitogen-activated protein kinases (MAPKs). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,235 probably benign Het
Angptl1 A T 1: 156,857,224 Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 51,805,593 probably null Het
Blm CTC CTCATCCTCCTCATC 7: 80,512,927 probably benign Het
Car13 T C 3: 14,654,914 Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,712,523 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cdh26 T C 2: 178,466,631 C341R probably damaging Het
Chga GCA GCACCA 12: 102,561,421 probably benign Het
Col11a1 A T 3: 114,217,001 I1689L unknown Het
Dnah6 T G 6: 73,101,889 S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,455,186 probably benign Het
Fah A C 7: 84,589,628 N336K probably damaging Het
Fbxo11 A T 17: 87,996,053 I664K Het
Fcgbp A G 7: 28,089,755 D582G probably benign Het
Gabre C CCGGCTA X: 72,270,057 probably null Het
Gm1110 A G 9: 26,920,640 Y72H probably damaging Het
Gm14025 A G 2: 129,038,794 F404S Het
Inpp5e C T 2: 26,408,377 A71T possibly damaging Het
Iqcm C T 8: 75,577,899 T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 93,018,283 probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 93,018,299 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lyst A G 13: 13,634,363 D206G probably benign Het
Map4k5 A T 12: 69,856,856 D58E probably damaging Het
Mapkapk2 A G 1: 131,056,513 S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,652,529 probably benign Het
Men1 T C 19: 6,340,116 S600P probably damaging Het
Mllt1 C A 17: 56,896,301 M393I possibly damaging Het
Mllt1 C T 17: 56,896,300 V394M probably benign Het
Nacc1 T C 8: 84,676,219 E315G possibly damaging Het
Nid2 TAACACCGCCA TA 14: 19,751,366 probably benign Het
Olfr1484 T A 19: 13,586,051 I206N probably damaging Het
Parp2 A G 14: 50,817,386 E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,279,375 probably null Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Ppp3cc T C 14: 70,267,339 T73A possibly damaging Het
Prdm15 C T 16: 97,799,629 D810N probably damaging Het
Sdk2 T C 11: 113,885,252 E208G probably benign Het
Smurf2 G T 11: 106,852,587 P211Q probably benign Het
Snx25 C A 8: 46,116,181 probably null Het
Spata6 T A 4: 111,828,305 M469K probably benign Het
Spta1 G T 1: 174,231,360 A1954S possibly damaging Het
Stard8 GAG GAGTAG X: 99,066,515 probably null Het
Tfeb AGC AGCGGC 17: 47,786,102 probably benign Het
Tlcd1 T A 11: 78,180,194 L203Q probably benign Het
Tlr11 T C 14: 50,361,225 F223L possibly damaging Het
Usp48 T A 4: 137,605,795 V100D probably damaging Het
Vmn2r56 G A 7: 12,694,830 T503I probably benign Het
Vps18 T C 2: 119,297,390 L898P probably damaging Het
Zfp706 T A 15: 37,003,705 Y39F probably benign Het
Zhx3 T A 2: 160,781,806 N147I probably damaging Het
Other mutations in Prpf4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Prpf4b APN 13 34883907 missense probably benign 0.23
IGL00639:Prpf4b APN 13 34899173 missense possibly damaging 0.70
IGL00901:Prpf4b APN 13 34894482 missense probably damaging 1.00
IGL01301:Prpf4b APN 13 34884291 missense probably benign 0.23
IGL02027:Prpf4b APN 13 34889571 missense probably benign 0.35
IGL02111:Prpf4b APN 13 34883961 missense probably benign 0.23
IGL02256:Prpf4b APN 13 34899878 missense probably damaging 0.98
IGL02590:Prpf4b APN 13 34888146 unclassified probably benign
IGL03389:Prpf4b APN 13 34900456 splice site probably benign
IGL03411:Prpf4b APN 13 34895359 missense probably damaging 1.00
ANU18:Prpf4b UTSW 13 34884291 missense probably benign 0.23
PIT4260001:Prpf4b UTSW 13 34884291 missense probably benign 0.23
PIT4696001:Prpf4b UTSW 13 34899842 missense probably benign 0.01
R0114:Prpf4b UTSW 13 34890488 splice site probably benign
R0157:Prpf4b UTSW 13 34884031 unclassified probably benign
R1551:Prpf4b UTSW 13 34894443 missense possibly damaging 0.91
R1587:Prpf4b UTSW 13 34892150 missense probably benign 0.09
R2105:Prpf4b UTSW 13 34884231 unclassified probably benign
R2152:Prpf4b UTSW 13 34900419 missense probably benign 0.04
R2432:Prpf4b UTSW 13 34883341 unclassified probably benign
R3802:Prpf4b UTSW 13 34883682 unclassified probably benign
R3803:Prpf4b UTSW 13 34883682 unclassified probably benign
R3804:Prpf4b UTSW 13 34883682 unclassified probably benign
R3982:Prpf4b UTSW 13 34884213 unclassified probably benign
R4603:Prpf4b UTSW 13 34888164 unclassified probably benign
R4633:Prpf4b UTSW 13 34900442 missense probably damaging 1.00
R4649:Prpf4b UTSW 13 34899971 missense probably benign 0.06
R4651:Prpf4b UTSW 13 34899971 missense probably benign 0.06
R4653:Prpf4b UTSW 13 34899971 missense probably benign 0.06
R5022:Prpf4b UTSW 13 34883599 unclassified probably benign
R5028:Prpf4b UTSW 13 34899975 missense probably damaging 1.00
R5232:Prpf4b UTSW 13 34883590 unclassified probably benign
R5313:Prpf4b UTSW 13 34894549 missense probably damaging 1.00
R5440:Prpf4b UTSW 13 34884093 unclassified probably benign
R5511:Prpf4b UTSW 13 34884054 unclassified probably benign
R5863:Prpf4b UTSW 13 34899128 missense possibly damaging 0.51
R5981:Prpf4b UTSW 13 34886710 missense probably benign 0.23
R6360:Prpf4b UTSW 13 34901433 missense probably damaging 0.99
R6398:Prpf4b UTSW 13 34900371 missense probably damaging 1.00
R6556:Prpf4b UTSW 13 34896032 missense probably damaging 0.98
R6880:Prpf4b UTSW 13 34894453 missense possibly damaging 0.69
R7133:Prpf4b UTSW 13 34901494 missense probably benign 0.02
R7148:Prpf4b UTSW 13 34894472 missense probably benign 0.04
R7208:Prpf4b UTSW 13 34884011 missense unknown
R7966:Prpf4b UTSW 13 34901445 missense probably damaging 0.96
R8241:Prpf4b UTSW 13 34895991 missense probably damaging 1.00
R8298:Prpf4b UTSW 13 34888183 missense unknown
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04