Incidental Mutation 'RF002:Parp2'
ID 602581
Institutional Source Beutler Lab
Gene Symbol Parp2
Ensembl Gene ENSMUSG00000036023
Gene Name poly (ADP-ribose) polymerase family, member 2
Synonyms PARP-2, Adprtl2, C78626, Aspartl2, Adprt2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock # RF002 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 50807841-50821301 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 50817386 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 262 (E262G)
Ref Sequence ENSEMBL: ENSMUSP00000048877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036126] [ENSMUST00000227810]
AlphaFold O88554
Predicted Effect probably damaging
Transcript: ENSMUST00000036126
AA Change: E262G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048877
Gene: ENSMUSG00000036023
AA Change: E262G

WGR 95 175 1.17e-35 SMART
Pfam:PARP_reg 208 338 1.4e-49 PFAM
Pfam:PARP 341 553 1.8e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227810
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes poly(ADP-ribosyl)transferase-like 2 protein, which contains a catalytic domain and is capable of catalyzing a poly(ADP-ribosyl)ation reaction. This protein has a catalytic domain which is homologous to that of poly (ADP-ribosyl) transferase, but lacks an N-terminal DNA binding domain which activates the C-terminal catalytic domain of poly (ADP-ribosyl) transferase. The basic residues within the N-terminal region of this protein may bear potential DNA-binding properties, and may be involved in the nuclear and/or nucleolar targeting of the protein. Two alternatively spliced transcript variants encoding distinct isoforms have been found. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant animals are sensitive to gamma radiation. Epithelial crypt degeneration and DNA repair deficiency is apparent following radiation-induced injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,235 probably benign Het
Angptl1 A T 1: 156,857,224 Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 51,805,593 probably null Het
Blm CTC CTCATCCTCCTCATC 7: 80,512,927 probably benign Het
Car13 T C 3: 14,654,914 Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,712,523 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cdh26 T C 2: 178,466,631 C341R probably damaging Het
Chga GCA GCACCA 12: 102,561,421 probably benign Het
Col11a1 A T 3: 114,217,001 I1689L unknown Het
Dnah6 T G 6: 73,101,889 S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,455,186 probably benign Het
Fah A C 7: 84,589,628 N336K probably damaging Het
Fbxo11 A T 17: 87,996,053 I664K Het
Fcgbp A G 7: 28,089,755 D582G probably benign Het
Gabre C CCGGCTA X: 72,270,057 probably null Het
Gm1110 A G 9: 26,920,640 Y72H probably damaging Het
Gm14025 A G 2: 129,038,794 F404S Het
Inpp5e C T 2: 26,408,377 A71T possibly damaging Het
Iqcm C T 8: 75,577,899 T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 93,018,283 probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 93,018,299 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lyst A G 13: 13,634,363 D206G probably benign Het
Map4k5 A T 12: 69,856,856 D58E probably damaging Het
Mapkapk2 A G 1: 131,056,513 S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,652,529 probably benign Het
Men1 T C 19: 6,340,116 S600P probably damaging Het
Mllt1 C T 17: 56,896,300 V394M probably benign Het
Mllt1 C A 17: 56,896,301 M393I possibly damaging Het
Nacc1 T C 8: 84,676,219 E315G possibly damaging Het
Nid2 TAACACCGCCA TA 14: 19,751,366 probably benign Het
Olfr1484 T A 19: 13,586,051 I206N probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,279,375 probably null Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Ppp3cc T C 14: 70,267,339 T73A possibly damaging Het
Prdm15 C T 16: 97,799,629 D810N probably damaging Het
Prpf4b T A 13: 34,884,236 S349R unknown Het
Sdk2 T C 11: 113,885,252 E208G probably benign Het
Smurf2 G T 11: 106,852,587 P211Q probably benign Het
Snx25 C A 8: 46,116,181 probably null Het
Spata6 T A 4: 111,828,305 M469K probably benign Het
Spta1 G T 1: 174,231,360 A1954S possibly damaging Het
Stard8 GAG GAGTAG X: 99,066,515 probably null Het
Tfeb AGC AGCGGC 17: 47,786,102 probably benign Het
Tlcd1 T A 11: 78,180,194 L203Q probably benign Het
Tlr11 T C 14: 50,361,225 F223L possibly damaging Het
Usp48 T A 4: 137,605,795 V100D probably damaging Het
Vmn2r56 G A 7: 12,694,830 T503I probably benign Het
Vps18 T C 2: 119,297,390 L898P probably damaging Het
Zfp706 T A 15: 37,003,705 Y39F probably benign Het
Zhx3 T A 2: 160,781,806 N147I probably damaging Het
Other mutations in Parp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02826:Parp2 APN 14 50815415 missense probably benign 0.04
IGL03022:Parp2 APN 14 50821096 missense probably damaging 0.99
IGL03051:Parp2 APN 14 50819348 splice site probably benign
R0110:Parp2 UTSW 14 50819673 missense probably damaging 1.00
R0450:Parp2 UTSW 14 50819673 missense probably damaging 1.00
R0510:Parp2 UTSW 14 50819673 missense probably damaging 1.00
R1442:Parp2 UTSW 14 50819275 critical splice donor site probably null
R1590:Parp2 UTSW 14 50810544 missense probably benign 0.19
R1668:Parp2 UTSW 14 50820856 missense probably benign 0.00
R1806:Parp2 UTSW 14 50819379 missense probably damaging 0.99
R1846:Parp2 UTSW 14 50815386 nonsense probably null
R2029:Parp2 UTSW 14 50810086 missense probably benign 0.14
R2990:Parp2 UTSW 14 50817000 missense probably benign
R3933:Parp2 UTSW 14 50819387 missense probably benign 0.44
R4921:Parp2 UTSW 14 50819268 missense probably damaging 0.99
R6406:Parp2 UTSW 14 50819477 missense probably benign
R6799:Parp2 UTSW 14 50821096 missense probably damaging 0.99
R7105:Parp2 UTSW 14 50810064 frame shift probably null
R7250:Parp2 UTSW 14 50817344 missense probably benign
R7606:Parp2 UTSW 14 50820030 missense probably damaging 1.00
R8040:Parp2 UTSW 14 50810173 missense probably benign
R8523:Parp2 UTSW 14 50819790 critical splice donor site probably null
R9089:Parp2 UTSW 14 50814870 missense probably damaging 1.00
R9203:Parp2 UTSW 14 50819393 missense probably benign 0.32
X0019:Parp2 UTSW 14 50817099 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04