Incidental Mutation 'RF002:AY358078'
ID 602582
Institutional Source Beutler Lab
Gene Symbol AY358078
Ensembl Gene ENSMUSG00000050961
Gene Name cDNA sequence AY358078
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # RF002 (G1)
Quality Score 214.458
Status Not validated
Chromosome 14
Chromosomal Location 52037503-52063816 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to TAGGATAATGC at 52043050 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053821]
AlphaFold Q6UY53
Predicted Effect probably null
Transcript: ENSMUST00000053821
SMART Domains Protein: ENSMUSP00000078129
Gene: ENSMUSG00000050961

DomainStartEndE-ValueType
Pfam:Takusan 91 171 5.5e-26 PFAM
coiled coil region 187 220 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,475,262 (GRCm39) probably benign Het
AI837181 GGC GGCTGC 19: 5,475,263 (GRCm39) probably benign Het
Angptl1 A T 1: 156,684,794 (GRCm39) Q321L possibly damaging Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT 7: 80,162,653 (GRCm39) probably benign Het
Blm CTC CTCATCCTCCTCATC 7: 80,162,675 (GRCm39) probably benign Het
Car13 T C 3: 14,719,974 (GRCm39) Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,619,805 (GRCm39) probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,619,810 (GRCm39) probably benign Het
Cdh26 T C 2: 178,108,424 (GRCm39) C341R probably damaging Het
Chga GCA GCACCA 12: 102,527,680 (GRCm39) probably benign Het
Col11a1 A T 3: 114,010,650 (GRCm39) I1689L unknown Het
Dnah6 T G 6: 73,078,872 (GRCm39) S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,674,160 (GRCm39) probably benign Het
Fah A C 7: 84,238,836 (GRCm39) N336K probably damaging Het
Fbxo11 A T 17: 88,303,481 (GRCm39) I664K Het
Fcgbp A G 7: 27,789,180 (GRCm39) D582G probably benign Het
Gabre C CCGGCTA X: 71,313,663 (GRCm39) probably null Het
Garin5a CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA 7: 44,149,944 (GRCm39) probably null Het
Gm1110 A G 9: 26,831,936 (GRCm39) Y72H probably damaging Het
Inpp5e C T 2: 26,298,389 (GRCm39) A71T possibly damaging Het
Iqcm C T 8: 76,304,527 (GRCm39) T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 92,925,590 (GRCm39) probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 92,925,606 (GRCm39) probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 75,185,014 (GRCm39) probably benign Het
Lyst A G 13: 13,808,948 (GRCm39) D206G probably benign Het
Map4k5 A T 12: 69,903,630 (GRCm39) D58E probably damaging Het
Mapkapk2 A G 1: 130,984,250 (GRCm39) S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,702,545 (GRCm39) probably benign Het
Men1 T C 19: 6,390,146 (GRCm39) S600P probably damaging Het
Mllt1 C T 17: 57,203,300 (GRCm39) V394M probably benign Het
Mllt1 C A 17: 57,203,301 (GRCm39) M393I possibly damaging Het
Nacc1 T C 8: 85,402,848 (GRCm39) E315G possibly damaging Het
Nefh GGGGACTTGGCCTC GGGGACTTGGCCTCACCTAGGGACTTGGCCTC 11: 4,891,047 (GRCm39) probably benign Het
Nefh GACTTGGCCTC GACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,050 (GRCm39) probably benign Het
Nid2 TAACACCGCCA TA 14: 19,801,434 (GRCm39) probably benign Het
Or5b122 T A 19: 13,563,415 (GRCm39) I206N probably damaging Het
Parp2 A G 14: 51,054,843 (GRCm39) E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,006,686 (GRCm39) probably null Het
Pop1 G A 15: 34,502,583 (GRCm39) G90D probably damaging Het
Ppp3cc T C 14: 70,504,788 (GRCm39) T73A possibly damaging Het
Prdm15 C T 16: 97,600,829 (GRCm39) D810N probably damaging Het
Prpf4b T A 13: 35,068,219 (GRCm39) S349R unknown Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,756,780 (GRCm39) probably benign Het
Rassf6 GTAGAGCAATGGGGATTC GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC 5: 90,756,784 (GRCm39) probably null Het
Sdk2 T C 11: 113,776,078 (GRCm39) E208G probably benign Het
Smurf2 G T 11: 106,743,413 (GRCm39) P211Q probably benign Het
Snx25 C A 8: 46,569,218 (GRCm39) probably null Het
Spata6 T A 4: 111,685,502 (GRCm39) M469K probably benign Het
Spta1 G T 1: 174,058,926 (GRCm39) A1954S possibly damaging Het
Sry CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG CTGGTCATGGAACTGCTG Y: 2,662,564 (GRCm39) probably benign Het
Stard8 GAG GAGTAG X: 98,110,121 (GRCm39) probably null Het
Tfeb AGC AGCGGC 17: 48,097,027 (GRCm39) probably benign Het
Tlcd1 T A 11: 78,071,020 (GRCm39) L203Q probably benign Het
Tlr11 T C 14: 50,598,682 (GRCm39) F223L possibly damaging Het
Usp48 T A 4: 137,333,106 (GRCm39) V100D probably damaging Het
Vinac1 A G 2: 128,880,714 (GRCm39) F404S Het
Vmn2r56 G A 7: 12,428,757 (GRCm39) T503I probably benign Het
Vps18 T C 2: 119,127,871 (GRCm39) L898P probably damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,013,434 (GRCm39) probably benign Het
Zfp706 T A 15: 37,003,949 (GRCm39) Y39F probably benign Het
Zhx3 T A 2: 160,623,726 (GRCm39) N147I probably damaging Het
Other mutations in AY358078
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:AY358078 APN 14 52,043,166 (GRCm39) splice site probably benign
IGL02053:AY358078 APN 14 52,043,009 (GRCm39) missense unknown
IGL02057:AY358078 APN 14 52,057,762 (GRCm39) missense unknown
IGL02498:AY358078 APN 14 52,040,944 (GRCm39) missense probably benign 0.00
FR4737:AY358078 UTSW 14 52,043,155 (GRCm39) missense unknown
R0140:AY358078 UTSW 14 52,063,399 (GRCm39) missense probably benign 0.12
R0466:AY358078 UTSW 14 52,043,089 (GRCm39) missense unknown
R0496:AY358078 UTSW 14 52,040,989 (GRCm39) missense unknown
R1546:AY358078 UTSW 14 52,057,876 (GRCm39) splice site probably null
R1793:AY358078 UTSW 14 52,042,051 (GRCm39) missense unknown
R1867:AY358078 UTSW 14 52,037,504 (GRCm39) start codon destroyed probably null 0.01
R1993:AY358078 UTSW 14 52,063,519 (GRCm39) missense probably damaging 1.00
R1994:AY358078 UTSW 14 52,063,519 (GRCm39) missense probably damaging 1.00
R1995:AY358078 UTSW 14 52,063,519 (GRCm39) missense probably damaging 1.00
R2184:AY358078 UTSW 14 52,063,445 (GRCm39) missense probably damaging 1.00
R2322:AY358078 UTSW 14 52,042,147 (GRCm39) missense unknown
R2441:AY358078 UTSW 14 52,037,546 (GRCm39) missense probably benign 0.00
R3851:AY358078 UTSW 14 52,043,010 (GRCm39) missense unknown
R3852:AY358078 UTSW 14 52,043,010 (GRCm39) missense unknown
R4600:AY358078 UTSW 14 52,063,532 (GRCm39) missense possibly damaging 0.89
R4603:AY358078 UTSW 14 52,063,532 (GRCm39) missense possibly damaging 0.89
R4610:AY358078 UTSW 14 52,063,532 (GRCm39) missense possibly damaging 0.89
R4611:AY358078 UTSW 14 52,063,532 (GRCm39) missense possibly damaging 0.89
R4916:AY358078 UTSW 14 52,040,108 (GRCm39) missense unknown
R5096:AY358078 UTSW 14 52,063,575 (GRCm39) missense probably benign 0.19
R5143:AY358078 UTSW 14 52,040,006 (GRCm39) missense unknown
R5609:AY358078 UTSW 14 52,042,065 (GRCm39) missense unknown
R5651:AY358078 UTSW 14 52,059,617 (GRCm39) missense unknown
R6345:AY358078 UTSW 14 52,063,749 (GRCm39) missense probably damaging 1.00
R6988:AY358078 UTSW 14 52,063,644 (GRCm39) missense probably damaging 0.99
R7340:AY358078 UTSW 14 52,063,716 (GRCm39) missense probably damaging 1.00
R8432:AY358078 UTSW 14 52,059,635 (GRCm39) missense unknown
R8684:AY358078 UTSW 14 52,059,597 (GRCm39) nonsense probably null
RF017:AY358078 UTSW 14 52,043,050 (GRCm39) nonsense probably null
RF025:AY358078 UTSW 14 52,043,046 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGAAGCTAGCTGGGAATCAC -3'
(R):5'- AGTCAATGCCAATGACTCTGAC -3'

Sequencing Primer
(F):5'- TGTGGTTCAGCATCAGGC -3'
(R):5'- AGATACCTACAGGCTCTGCTG -3'
Posted On 2019-12-04