Incidental Mutation 'RF002:AY358078'
Institutional Source Beutler Lab
Gene Symbol AY358078
Ensembl Gene ENSMUSG00000050961
Gene NamecDNA sequence AY358078
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #RF002 (G1)
Quality Score214.458
Status Not validated
Chromosomal Location51800046-51826359 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to TAGGATAATGC at 51805593 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053821]
Predicted Effect probably null
Transcript: ENSMUST00000053821
SMART Domains Protein: ENSMUSP00000078129
Gene: ENSMUSG00000050961

Pfam:Takusan 91 171 5.5e-26 PFAM
coiled coil region 187 220 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,235 probably benign Het
Angptl1 A T 1: 156,857,224 Q321L possibly damaging Het
Blm CTC CTCATCCTCCTCATC 7: 80,512,927 probably benign Het
Car13 T C 3: 14,654,914 Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,712,523 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cdh26 T C 2: 178,466,631 C341R probably damaging Het
Chga GCA GCACCA 12: 102,561,421 probably benign Het
Col11a1 A T 3: 114,217,001 I1689L unknown Het
Dnah6 T G 6: 73,101,889 S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,455,186 probably benign Het
Fah A C 7: 84,589,628 N336K probably damaging Het
Fbxo11 A T 17: 87,996,053 I664K Het
Fcgbp A G 7: 28,089,755 D582G probably benign Het
Gabre C CCGGCTA X: 72,270,057 probably null Het
Gm1110 A G 9: 26,920,640 Y72H probably damaging Het
Gm14025 A G 2: 129,038,794 F404S Het
Inpp5e C T 2: 26,408,377 A71T possibly damaging Het
Iqcm C T 8: 75,577,899 T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 93,018,283 probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 93,018,299 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lyst A G 13: 13,634,363 D206G probably benign Het
Map4k5 A T 12: 69,856,856 D58E probably damaging Het
Mapkapk2 A G 1: 131,056,513 S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,652,529 probably benign Het
Men1 T C 19: 6,340,116 S600P probably damaging Het
Mllt1 C T 17: 56,896,300 V394M probably benign Het
Mllt1 C A 17: 56,896,301 M393I possibly damaging Het
Nacc1 T C 8: 84,676,219 E315G possibly damaging Het
Nid2 TAACACCGCCA TA 14: 19,751,366 probably benign Het
Olfr1484 T A 19: 13,586,051 I206N probably damaging Het
Parp2 A G 14: 50,817,386 E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,279,375 probably null Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Ppp3cc T C 14: 70,267,339 T73A possibly damaging Het
Prdm15 C T 16: 97,799,629 D810N probably damaging Het
Prpf4b T A 13: 34,884,236 S349R unknown Het
Sdk2 T C 11: 113,885,252 E208G probably benign Het
Smurf2 G T 11: 106,852,587 P211Q probably benign Het
Snx25 C A 8: 46,116,181 probably null Het
Spata6 T A 4: 111,828,305 M469K probably benign Het
Spta1 G T 1: 174,231,360 A1954S possibly damaging Het
Stard8 GAG GAGTAG X: 99,066,515 probably null Het
Tfeb AGC AGCGGC 17: 47,786,102 probably benign Het
Tlcd1 T A 11: 78,180,194 L203Q probably benign Het
Tlr11 T C 14: 50,361,225 F223L possibly damaging Het
Usp48 T A 4: 137,605,795 V100D probably damaging Het
Vmn2r56 G A 7: 12,694,830 T503I probably benign Het
Vps18 T C 2: 119,297,390 L898P probably damaging Het
Zfp706 T A 15: 37,003,705 Y39F probably benign Het
Zhx3 T A 2: 160,781,806 N147I probably damaging Het
Other mutations in AY358078
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:AY358078 APN 14 51805709 splice site probably benign
IGL02053:AY358078 APN 14 51805552 missense unknown
IGL02057:AY358078 APN 14 51820305 missense unknown
IGL02498:AY358078 APN 14 51803487 missense probably benign 0.00
FR4737:AY358078 UTSW 14 51805698 missense unknown
R0140:AY358078 UTSW 14 51825942 missense probably benign 0.12
R0466:AY358078 UTSW 14 51805632 missense unknown
R0496:AY358078 UTSW 14 51803532 missense unknown
R1546:AY358078 UTSW 14 51820419 splice site probably null
R1793:AY358078 UTSW 14 51804594 missense unknown
R1867:AY358078 UTSW 14 51800047 start codon destroyed probably null 0.01
R1993:AY358078 UTSW 14 51826062 missense probably damaging 1.00
R1994:AY358078 UTSW 14 51826062 missense probably damaging 1.00
R1995:AY358078 UTSW 14 51826062 missense probably damaging 1.00
R2184:AY358078 UTSW 14 51825988 missense probably damaging 1.00
R2322:AY358078 UTSW 14 51804690 missense unknown
R2441:AY358078 UTSW 14 51800089 missense probably benign 0.00
R3851:AY358078 UTSW 14 51805553 missense unknown
R3852:AY358078 UTSW 14 51805553 missense unknown
R4600:AY358078 UTSW 14 51826075 missense possibly damaging 0.89
R4603:AY358078 UTSW 14 51826075 missense possibly damaging 0.89
R4610:AY358078 UTSW 14 51826075 missense possibly damaging 0.89
R4611:AY358078 UTSW 14 51826075 missense possibly damaging 0.89
R4916:AY358078 UTSW 14 51802651 missense unknown
R5096:AY358078 UTSW 14 51826118 missense probably benign 0.19
R5143:AY358078 UTSW 14 51802549 missense unknown
R5609:AY358078 UTSW 14 51804608 missense unknown
R5651:AY358078 UTSW 14 51822160 missense unknown
R6345:AY358078 UTSW 14 51826292 missense probably damaging 1.00
R6988:AY358078 UTSW 14 51826187 missense probably damaging 0.99
R7340:AY358078 UTSW 14 51826259 missense probably damaging 1.00
R8432:AY358078 UTSW 14 51822178 missense unknown
R8684:AY358078 UTSW 14 51822140 nonsense probably null
RF017:AY358078 UTSW 14 51805593 nonsense probably null
RF025:AY358078 UTSW 14 51805589 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04