Incidental Mutation 'RF002:Lrch1'
ID602584
Institutional Source Beutler Lab
Gene Symbol Lrch1
Ensembl Gene ENSMUSG00000068015
Gene Nameleucine-rich repeats and calponin homology (CH) domain containing 1
Synonyms4832412D13Rik, Chdc1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF002 (G1)
Quality Score214.458
Status Not validated
Chromosome14
Chromosomal Location74754675-74947876 bp(-) (GRCm38)
Type of Mutationsmall deletion (3 aa in frame mutation)
DNA Base Change (assembly) TTGGTGGTGCTGGTGG to TTGGTGG at 74947574 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088970] [ENSMUST00000228252]
Predicted Effect probably benign
Transcript: ENSMUST00000088970
SMART Domains Protein: ENSMUSP00000086363
Gene: ENSMUSG00000068015

DomainStartEndE-ValueType
low complexity region 25 44 N/A INTRINSIC
LRR 109 131 1.86e1 SMART
LRR_TYP 132 155 3.39e-3 SMART
LRR 177 199 1.41e1 SMART
LRR 200 223 4.34e-1 SMART
LRR 245 268 1.66e1 SMART
low complexity region 306 322 N/A INTRINSIC
CH 591 698 1.71e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228252
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a leucine-rich repeat and a calponin homology domain. Polymorphism in this gene may be associated with susceptibililty to knee osteoarthritis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous knockout leads to increased susceptibility to experimental autoimmune encephalomyelitis as a result of increased migration of T cells into the central nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,235 probably benign Het
Angptl1 A T 1: 156,857,224 Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 51,805,593 probably null Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably benign Het
Blm CTC CTCATCCTCCTCATC 7: 80,512,927 probably benign Het
Car13 T C 3: 14,654,914 Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,712,523 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cdh26 T C 2: 178,466,631 C341R probably damaging Het
Chga GCA GCACCA 12: 102,561,421 probably benign Het
Col11a1 A T 3: 114,217,001 I1689L unknown Het
Dnah6 T G 6: 73,101,889 S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,455,186 probably benign Het
Fah A C 7: 84,589,628 N336K probably damaging Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Fbxo11 A T 17: 87,996,053 I664K Het
Fcgbp A G 7: 28,089,755 D582G probably benign Het
Gabre C CCGGCTA X: 72,270,057 probably null Het
Gm1110 A G 9: 26,920,640 Y72H probably damaging Het
Gm14025 A G 2: 129,038,794 F404S Het
Inpp5e C T 2: 26,408,377 A71T possibly damaging Het
Iqcm C T 8: 75,577,899 T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 93,018,283 probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 93,018,299 probably benign Het
Lyst A G 13: 13,634,363 D206G probably benign Het
Map4k5 A T 12: 69,856,856 D58E probably damaging Het
Mapkapk2 A G 1: 131,056,513 S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,652,529 probably benign Het
Men1 T C 19: 6,340,116 S600P probably damaging Het
Mllt1 C T 17: 56,896,300 V394M probably benign Het
Mllt1 C A 17: 56,896,301 M393I possibly damaging Het
Nacc1 T C 8: 84,676,219 E315G possibly damaging Het
Nefh GGGGACTTGGCCTC GGGGACTTGGCCTCACCTAGGGACTTGGCCTC 11: 4,941,047 probably benign Het
Nefh GACTTGGCCTC GACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,050 probably benign Het
Nid2 TAACACCGCCA TA 14: 19,751,366 probably benign Het
Olfr1484 T A 19: 13,586,051 I206N probably damaging Het
Parp2 A G 14: 50,817,386 E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,279,375 probably null Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Ppp3cc T C 14: 70,267,339 T73A possibly damaging Het
Prdm15 C T 16: 97,799,629 D810N probably damaging Het
Prpf4b T A 13: 34,884,236 S349R unknown Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,608,921 probably benign Het
Rassf6 GTAGAGCAATGGGGATTC GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC 5: 90,608,925 probably null Het
Sdk2 T C 11: 113,885,252 E208G probably benign Het
Smurf2 G T 11: 106,852,587 P211Q probably benign Het
Snx25 C A 8: 46,116,181 probably null Het
Spata6 T A 4: 111,828,305 M469K probably benign Het
Spta1 G T 1: 174,231,360 A1954S possibly damaging Het
Sry CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG CTGGTCATGGAACTGCTG Y: 2,662,564 probably benign Het
Stard8 GAG GAGTAG X: 99,066,515 probably null Het
Tfeb AGC AGCGGC 17: 47,786,102 probably benign Het
Tlcd1 T A 11: 78,180,194 L203Q probably benign Het
Tlr11 T C 14: 50,361,225 F223L possibly damaging Het
Usp48 T A 4: 137,605,795 V100D probably damaging Het
Vmn2r56 G A 7: 12,694,830 T503I probably benign Het
Vps18 T C 2: 119,297,390 L898P probably damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp706 T A 15: 37,003,705 Y39F probably benign Het
Zhx3 T A 2: 160,781,806 N147I probably damaging Het
Other mutations in Lrch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Lrch1 APN 14 74757063 missense probably benign 0.22
IGL01137:Lrch1 APN 14 74757092 missense probably damaging 0.98
IGL01978:Lrch1 APN 14 74786342 missense probably damaging 1.00
IGL01988:Lrch1 APN 14 74795373 splice site probably benign
IGL02036:Lrch1 APN 14 74795293 splice site probably benign
IGL02650:Lrch1 APN 14 74813698 missense probably damaging 1.00
IGL03006:Lrch1 APN 14 74813620 missense probably damaging 0.99
IGL03106:Lrch1 APN 14 74835762 missense possibly damaging 0.84
IGL03353:Lrch1 APN 14 74858042 missense probably damaging 1.00
FR4304:Lrch1 UTSW 14 74819565 missense possibly damaging 0.81
LCD18:Lrch1 UTSW 14 74905021 intron probably benign
R0129:Lrch1 UTSW 14 74835746 missense probably benign 0.13
R0312:Lrch1 UTSW 14 74947594 missense possibly damaging 0.82
R0441:Lrch1 UTSW 14 74947545 missense possibly damaging 0.95
R0622:Lrch1 UTSW 14 74796051 missense probably benign 0.00
R1418:Lrch1 UTSW 14 74804269 splice site probably benign
R1618:Lrch1 UTSW 14 74813704 missense probably damaging 1.00
R2116:Lrch1 UTSW 14 74785531 missense probably damaging 1.00
R2428:Lrch1 UTSW 14 74807545 splice site probably benign
R3707:Lrch1 UTSW 14 74857997 missense probably damaging 0.99
R4352:Lrch1 UTSW 14 74818578 missense probably damaging 0.98
R5689:Lrch1 UTSW 14 74786324 missense probably damaging 1.00
R5754:Lrch1 UTSW 14 74817118 missense probably damaging 1.00
R6142:Lrch1 UTSW 14 74947500 missense probably damaging 1.00
R6469:Lrch1 UTSW 14 74817085 missense probably damaging 1.00
R6740:Lrch1 UTSW 14 74811623 missense probably benign
R6871:Lrch1 UTSW 14 74811623 missense probably benign
R7051:Lrch1 UTSW 14 74785522 missense probably damaging 1.00
R7438:Lrch1 UTSW 14 74757037 missense possibly damaging 0.88
R7509:Lrch1 UTSW 14 74947608 missense probably benign 0.25
R8037:Lrch1 UTSW 14 74786354 missense probably damaging 1.00
RF009:Lrch1 UTSW 14 74947574 small deletion probably benign
RF018:Lrch1 UTSW 14 74947555 frame shift probably null
RF019:Lrch1 UTSW 14 74947579 frame shift probably null
RF022:Lrch1 UTSW 14 74947574 small deletion probably benign
RF023:Lrch1 UTSW 14 74947566 frame shift probably null
RF037:Lrch1 UTSW 14 74947549 small deletion probably benign
RF039:Lrch1 UTSW 14 74947549 small deletion probably benign
RF043:Lrch1 UTSW 14 74947575 frame shift probably null
RF061:Lrch1 UTSW 14 74947555 frame shift probably null
RF061:Lrch1 UTSW 14 74947567 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTAGTAACACATTCGGGCCC -3'
(R):5'- GAAACCTTGGCGATCGAACTG -3'

Sequencing Primer
(F):5'- GTCTCACCTGCCCGAAC -3'
(R):5'- GATCGAACTGCTGCCTCCAC -3'
Posted On2019-12-04