Incidental Mutation 'RF002:Mllt1'
ID 602590
Institutional Source Beutler Lab
Gene Symbol Mllt1
Ensembl Gene ENSMUSG00000024212
Gene Name myeloid/lymphoid or mixed-lineage leukemia; translocated to, 1
Synonyms LTG19, BAM11, ENL
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # RF002 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 56892612-56935388 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 56896300 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 394 (V394M)
Ref Sequence ENSEMBL: ENSMUSP00000025053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025053]
AlphaFold Q9ERL0
Predicted Effect probably benign
Transcript: ENSMUST00000025053
AA Change: V394M

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000025053
Gene: ENSMUSG00000024212
AA Change: V394M

Pfam:YEATS 29 110 1.9e-28 PFAM
low complexity region 284 299 N/A INTRINSIC
low complexity region 357 384 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
low complexity region 440 464 N/A INTRINSIC
PDB:2LM0|A 465 547 3e-31 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Embryos homozygous for a knock-out allele die prior to E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,235 probably benign Het
Angptl1 A T 1: 156,857,224 Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 51,805,593 probably null Het
Blm CTC CTCATCCTCCTCATC 7: 80,512,927 probably benign Het
Car13 T C 3: 14,654,914 Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,712,523 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cdh26 T C 2: 178,466,631 C341R probably damaging Het
Chga GCA GCACCA 12: 102,561,421 probably benign Het
Col11a1 A T 3: 114,217,001 I1689L unknown Het
Dnah6 T G 6: 73,101,889 S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,455,186 probably benign Het
Fah A C 7: 84,589,628 N336K probably damaging Het
Fbxo11 A T 17: 87,996,053 I664K Het
Fcgbp A G 7: 28,089,755 D582G probably benign Het
Gabre C CCGGCTA X: 72,270,057 probably null Het
Gm1110 A G 9: 26,920,640 Y72H probably damaging Het
Gm14025 A G 2: 129,038,794 F404S Het
Inpp5e C T 2: 26,408,377 A71T possibly damaging Het
Iqcm C T 8: 75,577,899 T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 93,018,283 probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 93,018,299 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lyst A G 13: 13,634,363 D206G probably benign Het
Map4k5 A T 12: 69,856,856 D58E probably damaging Het
Mapkapk2 A G 1: 131,056,513 S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,652,529 probably benign Het
Men1 T C 19: 6,340,116 S600P probably damaging Het
Nacc1 T C 8: 84,676,219 E315G possibly damaging Het
Nid2 TAACACCGCCA TA 14: 19,751,366 probably benign Het
Olfr1484 T A 19: 13,586,051 I206N probably damaging Het
Parp2 A G 14: 50,817,386 E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,279,375 probably null Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Ppp3cc T C 14: 70,267,339 T73A possibly damaging Het
Prdm15 C T 16: 97,799,629 D810N probably damaging Het
Prpf4b T A 13: 34,884,236 S349R unknown Het
Sdk2 T C 11: 113,885,252 E208G probably benign Het
Smurf2 G T 11: 106,852,587 P211Q probably benign Het
Snx25 C A 8: 46,116,181 probably null Het
Spata6 T A 4: 111,828,305 M469K probably benign Het
Spta1 G T 1: 174,231,360 A1954S possibly damaging Het
Stard8 GAG GAGTAG X: 99,066,515 probably null Het
Tfeb AGC AGCGGC 17: 47,786,102 probably benign Het
Tlcd1 T A 11: 78,180,194 L203Q probably benign Het
Tlr11 T C 14: 50,361,225 F223L possibly damaging Het
Usp48 T A 4: 137,605,795 V100D probably damaging Het
Vmn2r56 G A 7: 12,694,830 T503I probably benign Het
Vps18 T C 2: 119,297,390 L898P probably damaging Het
Zfp706 T A 15: 37,003,705 Y39F probably benign Het
Zhx3 T A 2: 160,781,806 N147I probably damaging Het
Other mutations in Mllt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Mllt1 APN 17 56895086 missense probably damaging 1.00
IGL02554:Mllt1 APN 17 56899806 missense probably benign
IGL03064:Mllt1 APN 17 56900094 missense probably benign 0.03
Weissblut UTSW 17 56905819 missense probably damaging 0.99
R2176:Mllt1 UTSW 17 56897398 missense probably benign 0.00
R4455:Mllt1 UTSW 17 56919965 missense probably damaging 1.00
R4760:Mllt1 UTSW 17 56902630 missense probably benign 0.05
R4864:Mllt1 UTSW 17 56905819 missense probably damaging 0.99
R4914:Mllt1 UTSW 17 56899813 missense probably benign
R4916:Mllt1 UTSW 17 56899813 missense probably benign
R4917:Mllt1 UTSW 17 56899813 missense probably benign
R4918:Mllt1 UTSW 17 56899813 missense probably benign
R6169:Mllt1 UTSW 17 56899822 missense probably benign
R6508:Mllt1 UTSW 17 56927054 missense probably damaging 1.00
R7216:Mllt1 UTSW 17 56927042 missense probably damaging 1.00
R8865:Mllt1 UTSW 17 56900295 missense possibly damaging 0.89
R9094:Mllt1 UTSW 17 56905737 missense probably damaging 1.00
RF002:Mllt1 UTSW 17 56896301 missense possibly damaging 0.66
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04