Incidental Mutation 'RF002:Fbxo11'
ID602592
Institutional Source Beutler Lab
Gene Symbol Fbxo11
Ensembl Gene ENSMUSG00000005371
Gene NameF-box protein 11
SynonymsJf, GENA 104
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF002 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location87990859-88065291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87996053 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 664 (I664K)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005504]
Predicted Effect probably damaging
Transcript: ENSMUST00000005504
AA Change: I740K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005504
Gene: ENSMUSG00000005371
AA Change: I740K

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 21 73 N/A INTRINSIC
FBOX 162 202 2.44e-8 SMART
PbH1 398 420 1.37e3 SMART
PbH1 421 443 8.83e0 SMART
CASH 421 557 1.31e-7 SMART
PbH1 444 466 6.15e1 SMART
PbH1 467 489 1.78e3 SMART
PbH1 490 512 2.29e2 SMART
PbH1 513 535 7.67e2 SMART
PbH1 536 558 1.36e0 SMART
PbH1 559 581 3.59e0 SMART
CASH 573 695 2.35e0 SMART
PbH1 582 604 8.73e2 SMART
PbH1 605 627 4.28e2 SMART
PbH1 628 650 5.03e2 SMART
PbH1 651 673 3.79e1 SMART
PbH1 674 696 4.73e0 SMART
PbH1 697 719 1.86e2 SMART
CASH 711 840 9.31e-13 SMART
PbH1 720 742 2.91e0 SMART
PbH1 743 765 3.73e2 SMART
PbH1 766 788 1.62e2 SMART
PbH1 789 811 9.99e1 SMART
PbH1 812 833 1.21e3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000121206
Gene: ENSMUSG00000005371
AA Change: I664K

DomainStartEndE-ValueType
FBOX 87 127 2.44e-8 SMART
PbH1 323 345 1.37e3 SMART
PbH1 346 368 8.83e0 SMART
CASH 346 482 1.31e-7 SMART
PbH1 369 391 6.15e1 SMART
PbH1 392 414 1.78e3 SMART
PbH1 415 437 2.29e2 SMART
PbH1 438 460 7.67e2 SMART
PbH1 461 483 1.36e0 SMART
PbH1 484 506 3.59e0 SMART
CASH 498 620 2.35e0 SMART
PbH1 507 529 8.73e2 SMART
PbH1 530 552 4.28e2 SMART
PbH1 553 575 5.03e2 SMART
PbH1 576 598 3.79e1 SMART
PbH1 599 621 4.73e0 SMART
PbH1 622 644 1.86e2 SMART
CASH 636 765 9.31e-13 SMART
PbH1 645 667 2.91e0 SMART
PbH1 668 690 3.73e2 SMART
PbH1 691 713 1.62e2 SMART
PbH1 714 736 9.99e1 SMART
PbH1 737 758 1.21e3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135639
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit cleft palate, facial clefting, and perinatal lethality. Mice homozygous for a knock-out allele show neonatal lethality, thick epidermis, decreased hair follicle number, absent keratohyalin granules, and increased epidermal Snail protein levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,235 probably benign Het
Angptl1 A T 1: 156,857,224 Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 51,805,593 probably null Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably benign Het
Blm CTC CTCATCCTCCTCATC 7: 80,512,927 probably benign Het
Car13 T C 3: 14,654,914 Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,712,523 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cdh26 T C 2: 178,466,631 C341R probably damaging Het
Chga GCA GCACCA 12: 102,561,421 probably benign Het
Col11a1 A T 3: 114,217,001 I1689L unknown Het
Dnah6 T G 6: 73,101,889 S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,455,186 probably benign Het
Fah A C 7: 84,589,628 N336K probably damaging Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Fcgbp A G 7: 28,089,755 D582G probably benign Het
Gabre C CCGGCTA X: 72,270,057 probably null Het
Gm1110 A G 9: 26,920,640 Y72H probably damaging Het
Gm14025 A G 2: 129,038,794 F404S Het
Inpp5e C T 2: 26,408,377 A71T possibly damaging Het
Iqcm C T 8: 75,577,899 T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 93,018,283 probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 93,018,299 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lyst A G 13: 13,634,363 D206G probably benign Het
Map4k5 A T 12: 69,856,856 D58E probably damaging Het
Mapkapk2 A G 1: 131,056,513 S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,652,529 probably benign Het
Men1 T C 19: 6,340,116 S600P probably damaging Het
Mllt1 C T 17: 56,896,300 V394M probably benign Het
Mllt1 C A 17: 56,896,301 M393I possibly damaging Het
Nacc1 T C 8: 84,676,219 E315G possibly damaging Het
Nefh GGGGACTTGGCCTC GGGGACTTGGCCTCACCTAGGGACTTGGCCTC 11: 4,941,047 probably benign Het
Nefh GACTTGGCCTC GACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,050 probably benign Het
Nid2 TAACACCGCCA TA 14: 19,751,366 probably benign Het
Olfr1484 T A 19: 13,586,051 I206N probably damaging Het
Parp2 A G 14: 50,817,386 E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,279,375 probably null Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Ppp3cc T C 14: 70,267,339 T73A possibly damaging Het
Prdm15 C T 16: 97,799,629 D810N probably damaging Het
Prpf4b T A 13: 34,884,236 S349R unknown Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,608,921 probably benign Het
Rassf6 GTAGAGCAATGGGGATTC GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC 5: 90,608,925 probably null Het
Sdk2 T C 11: 113,885,252 E208G probably benign Het
Smurf2 G T 11: 106,852,587 P211Q probably benign Het
Snx25 C A 8: 46,116,181 probably null Het
Spata6 T A 4: 111,828,305 M469K probably benign Het
Spta1 G T 1: 174,231,360 A1954S possibly damaging Het
Sry CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG CTGGTCATGGAACTGCTG Y: 2,662,564 probably benign Het
Stard8 GAG GAGTAG X: 99,066,515 probably null Het
Tfeb AGC AGCGGC 17: 47,786,102 probably benign Het
Tlcd1 T A 11: 78,180,194 L203Q probably benign Het
Tlr11 T C 14: 50,361,225 F223L possibly damaging Het
Usp48 T A 4: 137,605,795 V100D probably damaging Het
Vmn2r56 G A 7: 12,694,830 T503I probably benign Het
Vps18 T C 2: 119,297,390 L898P probably damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp706 T A 15: 37,003,705 Y39F probably benign Het
Zhx3 T A 2: 160,781,806 N147I probably damaging Het
Other mutations in Fbxo11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01564:Fbxo11 APN 17 88002896 missense probably benign 0.02
IGL01908:Fbxo11 APN 17 87992300 missense probably benign 0.10
IGL02012:Fbxo11 APN 17 88012651 missense probably benign 0.00
IGL02149:Fbxo11 APN 17 87993759 missense possibly damaging 0.85
IGL02223:Fbxo11 APN 17 88009286 missense probably benign 0.03
IGL02586:Fbxo11 APN 17 88011283 unclassified probably benign
IGL03265:Fbxo11 APN 17 87992831 missense probably damaging 1.00
R0184:Fbxo11 UTSW 17 88008673 missense probably benign 0.19
R0335:Fbxo11 UTSW 17 88015613 missense possibly damaging 0.90
R0918:Fbxo11 UTSW 17 87997603 missense probably damaging 1.00
R1658:Fbxo11 UTSW 17 88012658 missense probably benign 0.01
R3725:Fbxo11 UTSW 17 88009286 missense probably benign 0.03
R4194:Fbxo11 UTSW 17 88009108 missense possibly damaging 0.94
R4884:Fbxo11 UTSW 17 87992333 missense probably damaging 0.99
R4902:Fbxo11 UTSW 17 88065274 unclassified probably benign
R5651:Fbxo11 UTSW 17 88015708 missense probably benign 0.01
R6137:Fbxo11 UTSW 17 88008669 missense probably benign 0.00
R6217:Fbxo11 UTSW 17 88008904 missense probably benign 0.00
R6482:Fbxo11 UTSW 17 88012658 missense probably benign 0.01
R7383:Fbxo11 UTSW 17 88002854 missense
R7813:Fbxo11 UTSW 17 88000817 missense
R7823:Fbxo11 UTSW 17 87993182 missense probably damaging 0.98
R7914:Fbxo11 UTSW 17 88012603 missense
R8835:Fbxo11 UTSW 17 88014446 missense
R8882:Fbxo11 UTSW 17 87997529 missense
R8883:Fbxo11 UTSW 17 87997616 missense
R9056:Fbxo11 UTSW 17 88002821 missense
X0060:Fbxo11 UTSW 17 87992306 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTTACTGACAATCGGCAG -3'
(R):5'- TTAGACGCAACAAAATTTGGGG -3'

Sequencing Primer
(F):5'- TACTGACAATCGGCAGATTTAAGGTG -3'
(R):5'- CGCAACAAAATTTGGGGAGGAC -3'
Posted On2019-12-04