Incidental Mutation 'RF002:Men1'
ID 602595
Institutional Source Beutler Lab
Gene Symbol Men1
Ensembl Gene ENSMUSG00000024947
Gene Name multiple endocrine neoplasia 1
Synonyms menin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # RF002 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 6334979-6340891 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 6340116 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 600 (S600P)
Ref Sequence ENSEMBL: ENSMUSP00000109130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025897] [ENSMUST00000056391] [ENSMUST00000078137] [ENSMUST00000079327] [ENSMUST00000113500] [ENSMUST00000113501] [ENSMUST00000113502] [ENSMUST00000113503] [ENSMUST00000113504] [ENSMUST00000124556] [ENSMUST00000130382] [ENSMUST00000142496] [ENSMUST00000152349] [ENSMUST00000166909] [ENSMUST00000170132]
AlphaFold O88559
Predicted Effect probably benign
Transcript: ENSMUST00000025897
SMART Domains Protein: ENSMUSP00000025897
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
S_TKc 16 273 2.41e-90 SMART
low complexity region 358 369 N/A INTRINSIC
low complexity region 425 444 N/A INTRINSIC
CNH 488 801 1.31e-128 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000056391
AA Change: S594P

PolyPhen 2 Score 0.589 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000058149
Gene: ENSMUSG00000024947
AA Change: S594P

DomainStartEndE-ValueType
Pfam:Menin 1 611 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000078137
AA Change: S539P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077272
Gene: ENSMUSG00000024947
AA Change: S539P

DomainStartEndE-ValueType
Pfam:Menin 1 396 2.6e-241 PFAM
Pfam:Menin 392 556 1.5e-62 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000079327
AA Change: S594P

PolyPhen 2 Score 0.589 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000078306
Gene: ENSMUSG00000024947
AA Change: S594P

DomainStartEndE-ValueType
Pfam:Menin 1 611 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113500
AA Change: S594P

PolyPhen 2 Score 0.589 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109128
Gene: ENSMUSG00000024947
AA Change: S594P

DomainStartEndE-ValueType
Pfam:Menin 1 611 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113501
AA Change: S559P

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109129
Gene: ENSMUSG00000024947
AA Change: S559P

DomainStartEndE-ValueType
Pfam:Menin 1 183 2.6e-104 PFAM
Pfam:Menin 184 576 3.2e-213 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113502
AA Change: S600P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109130
Gene: ENSMUSG00000024947
AA Change: S600P

DomainStartEndE-ValueType
Pfam:Menin 7 515 1.5e-254 PFAM
Pfam:Menin 536 615 4.9e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113503
AA Change: S599P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109131
Gene: ENSMUSG00000024947
AA Change: S599P

DomainStartEndE-ValueType
Pfam:Menin 1 616 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113504
AA Change: S594P

PolyPhen 2 Score 0.589 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109132
Gene: ENSMUSG00000024947
AA Change: S594P

DomainStartEndE-ValueType
Pfam:Menin 1 611 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124556
SMART Domains Protein: ENSMUSP00000121375
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:Pkinase 16 56 4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130382
SMART Domains Protein: ENSMUSP00000120123
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
S_TKc 16 233 3.4e-14 SMART
low complexity region 314 325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142496
SMART Domains Protein: ENSMUSP00000114243
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:Pkinase 16 56 4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152349
SMART Domains Protein: ENSMUSP00000115741
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:Pkinase 16 57 3.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166909
SMART Domains Protein: ENSMUSP00000133085
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 62 8.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170132
SMART Domains Protein: ENSMUSP00000126655
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 135 1.6e-81 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000128607
Gene: ENSMUSG00000024947
AA Change: S90P

DomainStartEndE-ValueType
Pfam:Menin 4 106 1.2e-28 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes menin, a putative tumor suppressor associated with a syndrome known as multiple endocrine neoplasia type 1. In vitro studies have shown menin is localized to the nucleus, possesses two functional nuclear localization signals, and inhibits transcriptional activation by JunD, however, the function of this protein is not known. Two messages have been detected on northern blots but the larger message has not been characterized. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for targeted null mutations die at embryonic day 11.5-13.5 with reduced size, edema, open neural tube and defects of the nervous system, heart and liver. Heterozygotes develop tumors of the pancreas, parathyroid, thyroid, adrenal and pituitary. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,235 probably benign Het
Angptl1 A T 1: 156,857,224 Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 51,805,593 probably null Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably benign Het
Blm CTC CTCATCCTCCTCATC 7: 80,512,927 probably benign Het
Car13 T C 3: 14,654,914 Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,712,523 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cdh26 T C 2: 178,466,631 C341R probably damaging Het
Chga GCA GCACCA 12: 102,561,421 probably benign Het
Col11a1 A T 3: 114,217,001 I1689L unknown Het
Dnah6 T G 6: 73,101,889 S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,455,186 probably benign Het
Fah A C 7: 84,589,628 N336K probably damaging Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Fbxo11 A T 17: 87,996,053 I664K Het
Fcgbp A G 7: 28,089,755 D582G probably benign Het
Gabre C CCGGCTA X: 72,270,057 probably null Het
Gm1110 A G 9: 26,920,640 Y72H probably damaging Het
Gm14025 A G 2: 129,038,794 F404S Het
Inpp5e C T 2: 26,408,377 A71T possibly damaging Het
Iqcm C T 8: 75,577,899 T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 93,018,283 probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 93,018,299 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lyst A G 13: 13,634,363 D206G probably benign Het
Map4k5 A T 12: 69,856,856 D58E probably damaging Het
Mapkapk2 A G 1: 131,056,513 S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,652,529 probably benign Het
Mllt1 C T 17: 56,896,300 V394M probably benign Het
Mllt1 C A 17: 56,896,301 M393I possibly damaging Het
Nacc1 T C 8: 84,676,219 E315G possibly damaging Het
Nefh GGGGACTTGGCCTC GGGGACTTGGCCTCACCTAGGGACTTGGCCTC 11: 4,941,047 probably benign Het
Nefh GACTTGGCCTC GACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,050 probably benign Het
Nid2 TAACACCGCCA TA 14: 19,751,366 probably benign Het
Olfr1484 T A 19: 13,586,051 I206N probably damaging Het
Parp2 A G 14: 50,817,386 E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,279,375 probably null Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Ppp3cc T C 14: 70,267,339 T73A possibly damaging Het
Prdm15 C T 16: 97,799,629 D810N probably damaging Het
Prpf4b T A 13: 34,884,236 S349R unknown Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,608,921 probably benign Het
Rassf6 GTAGAGCAATGGGGATTC GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC 5: 90,608,925 probably null Het
Sdk2 T C 11: 113,885,252 E208G probably benign Het
Smurf2 G T 11: 106,852,587 P211Q probably benign Het
Snx25 C A 8: 46,116,181 probably null Het
Spata6 T A 4: 111,828,305 M469K probably benign Het
Spta1 G T 1: 174,231,360 A1954S possibly damaging Het
Sry CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG CTGGTCATGGAACTGCTG Y: 2,662,564 probably benign Het
Stard8 GAG GAGTAG X: 99,066,515 probably null Het
Tfeb AGC AGCGGC 17: 47,786,102 probably benign Het
Tlcd1 T A 11: 78,180,194 L203Q probably benign Het
Tlr11 T C 14: 50,361,225 F223L possibly damaging Het
Usp48 T A 4: 137,605,795 V100D probably damaging Het
Vmn2r56 G A 7: 12,694,830 T503I probably benign Het
Vps18 T C 2: 119,297,390 L898P probably damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp706 T A 15: 37,003,705 Y39F probably benign Het
Zhx3 T A 2: 160,781,806 N147I probably damaging Het
Other mutations in Men1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Men1 APN 19 6337207 splice site probably null
IGL00160:Men1 APN 19 6337207 splice site probably null
IGL00161:Men1 APN 19 6337207 splice site probably null
IGL00229:Men1 APN 19 6337207 splice site probably null
IGL00231:Men1 APN 19 6337207 splice site probably null
IGL00232:Men1 APN 19 6337207 splice site probably null
IGL00434:Men1 APN 19 6337207 splice site probably null
IGL00467:Men1 APN 19 6337207 splice site probably null
IGL00468:Men1 APN 19 6337207 splice site probably null
IGL00470:Men1 APN 19 6337207 splice site probably null
IGL00476:Men1 APN 19 6337207 splice site probably null
IGL02305:Men1 APN 19 6340138 missense probably damaging 1.00
R0468:Men1 UTSW 19 6336923 missense probably null 0.99
R0856:Men1 UTSW 19 6335858 missense probably damaging 1.00
R1384:Men1 UTSW 19 6339891 missense probably benign 0.12
R1870:Men1 UTSW 19 6337630 missense probably damaging 1.00
R1987:Men1 UTSW 19 6338837 missense probably damaging 0.99
R2321:Men1 UTSW 19 6339838 missense possibly damaging 0.92
R4538:Men1 UTSW 19 6336754 missense possibly damaging 0.89
R4763:Men1 UTSW 19 6335072 critical splice donor site probably null
R6147:Men1 UTSW 19 6337242 missense probably damaging 0.97
R7598:Men1 UTSW 19 6339705 missense probably benign 0.06
R7726:Men1 UTSW 19 6337282 critical splice donor site probably null
R7949:Men1 UTSW 19 6338293 missense possibly damaging 0.80
R8283:Men1 UTSW 19 6336818 missense probably damaging 1.00
R8290:Men1 UTSW 19 6338286 missense probably benign 0.09
R8998:Men1 UTSW 19 6339930 missense probably benign 0.03
R8999:Men1 UTSW 19 6339930 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CACCTAGGAAAACGTCAGGGAC -3'
(R):5'- TGAAGGCTCCTAGTCACTGC -3'

Sequencing Primer
(F):5'- CAATGCTGCTCAGGCTCCAG -3'
(R):5'- GCTCCTAGTCACTGCAGGAC -3'
Posted On 2019-12-04