Incidental Mutation 'RF002:Olfr1484'
ID602596
Institutional Source Beutler Lab
Gene Symbol Olfr1484
Ensembl Gene ENSMUSG00000096289
Gene Nameolfactory receptor 1484
SynonymsMOR202-37, GA_x6K02T2RE5P-3917859-3918806
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #RF002 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location13583511-13588832 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13586051 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 206 (I206N)
Ref Sequence ENSEMBL: ENSMUSP00000146646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074180] [ENSMUST00000208104] [ENSMUST00000215567] [ENSMUST00000216014] [ENSMUST00000216369] [ENSMUST00000217451]
Predicted Effect probably damaging
Transcript: ENSMUST00000074180
AA Change: I249N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000073811
Gene: ENSMUSG00000096289
AA Change: I249N

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 7.4e-55 PFAM
Pfam:7TM_GPCR_Srsx 34 304 1.1e-5 PFAM
Pfam:7tm_1 40 289 3.7e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000208104
AA Change: I206N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000215567
AA Change: I249N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000216014
AA Change: I249N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000216369
AA Change: I206N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000217451
AA Change: I249N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,425,234 probably benign Het
AI837181 GGC GGCTGC 19: 5,425,235 probably benign Het
Angptl1 A T 1: 156,857,224 Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 51,805,593 probably null Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably benign Het
Blm CTC CTCATCCTCCTCATC 7: 80,512,927 probably benign Het
Car13 T C 3: 14,654,914 Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,712,523 probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,712,528 probably benign Het
Cdh26 T C 2: 178,466,631 C341R probably damaging Het
Chga GCA GCACCA 12: 102,561,421 probably benign Het
Col11a1 A T 3: 114,217,001 I1689L unknown Het
Dnah6 T G 6: 73,101,889 S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,455,186 probably benign Het
Fah A C 7: 84,589,628 N336K probably damaging Het
Fam71e1 CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA 7: 44,500,520 probably null Het
Fbxo11 A T 17: 87,996,053 I664K Het
Fcgbp A G 7: 28,089,755 D582G probably benign Het
Gabre C CCGGCTA X: 72,270,057 probably null Het
Gm1110 A G 9: 26,920,640 Y72H probably damaging Het
Gm14025 A G 2: 129,038,794 F404S Het
Inpp5e C T 2: 26,408,377 A71T possibly damaging Het
Iqcm C T 8: 75,577,899 T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 93,018,283 probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 93,018,299 probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 74,947,574 probably benign Het
Lyst A G 13: 13,634,363 D206G probably benign Het
Map4k5 A T 12: 69,856,856 D58E probably damaging Het
Mapkapk2 A G 1: 131,056,513 S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,652,529 probably benign Het
Men1 T C 19: 6,340,116 S600P probably damaging Het
Mllt1 C T 17: 56,896,300 V394M probably benign Het
Mllt1 C A 17: 56,896,301 M393I possibly damaging Het
Nacc1 T C 8: 84,676,219 E315G possibly damaging Het
Nefh GGGGACTTGGCCTC GGGGACTTGGCCTCACCTAGGGACTTGGCCTC 11: 4,941,047 probably benign Het
Nefh GACTTGGCCTC GACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,050 probably benign Het
Nid2 TAACACCGCCA TA 14: 19,751,366 probably benign Het
Parp2 A G 14: 50,817,386 E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,279,375 probably null Het
Pop1 G A 15: 34,502,437 G90D probably damaging Het
Ppp3cc T C 14: 70,267,339 T73A possibly damaging Het
Prdm15 C T 16: 97,799,629 D810N probably damaging Het
Prpf4b T A 13: 34,884,236 S349R unknown Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,608,921 probably benign Het
Rassf6 GTAGAGCAATGGGGATTC GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC 5: 90,608,925 probably null Het
Sdk2 T C 11: 113,885,252 E208G probably benign Het
Smurf2 G T 11: 106,852,587 P211Q probably benign Het
Snx25 C A 8: 46,116,181 probably null Het
Spata6 T A 4: 111,828,305 M469K probably benign Het
Spta1 G T 1: 174,231,360 A1954S possibly damaging Het
Sry CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG CTGGTCATGGAACTGCTG Y: 2,662,564 probably benign Het
Stard8 GAG GAGTAG X: 99,066,515 probably null Het
Tfeb AGC AGCGGC 17: 47,786,102 probably benign Het
Tlcd1 T A 11: 78,180,194 L203Q probably benign Het
Tlr11 T C 14: 50,361,225 F223L possibly damaging Het
Usp48 T A 4: 137,605,795 V100D probably damaging Het
Vmn2r56 G A 7: 12,694,830 T503I probably benign Het
Vps18 T C 2: 119,297,390 L898P probably damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp706 T A 15: 37,003,705 Y39F probably benign Het
Zhx3 T A 2: 160,781,806 N147I probably damaging Het
Other mutations in Olfr1484
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02029:Olfr1484 APN 19 13586104 missense probably benign 0.05
IGL02104:Olfr1484 APN 19 13585604 missense probably damaging 0.99
IGL02502:Olfr1484 APN 19 13585748 missense probably damaging 1.00
IGL03339:Olfr1484 APN 19 13586075 missense probably damaging 0.99
IGL03391:Olfr1484 APN 19 13586119 missense probably benign
R0008:Olfr1484 UTSW 19 13585876 missense probably benign 0.01
R0607:Olfr1484 UTSW 19 13586170 missense probably damaging 1.00
R0892:Olfr1484 UTSW 19 13585517 missense probably damaging 1.00
R1170:Olfr1484 UTSW 19 13586213 missense probably benign 0.00
R1605:Olfr1484 UTSW 19 13585630 missense probably benign 0.00
R1619:Olfr1484 UTSW 19 13585614 missense probably benign 0.03
R1793:Olfr1484 UTSW 19 13585415 missense probably benign 0.42
R2073:Olfr1484 UTSW 19 13585601 missense probably damaging 1.00
R2348:Olfr1484 UTSW 19 13586189 missense probably damaging 0.99
R5025:Olfr1484 UTSW 19 13585522 missense probably benign 0.03
R5383:Olfr1484 UTSW 19 13586075 missense probably damaging 0.99
R5771:Olfr1484 UTSW 19 13585508 missense probably damaging 0.98
R6002:Olfr1484 UTSW 19 13585417 start gained probably benign
R6992:Olfr1484 UTSW 19 13585447 missense possibly damaging 0.57
R7404:Olfr1484 UTSW 19 13585388 missense possibly damaging 0.88
R8358:Olfr1484 UTSW 19 13585400 missense probably damaging 0.97
X0019:Olfr1484 UTSW 19 13586208 missense probably null 0.00
X0019:Olfr1484 UTSW 19 13586209 missense probably damaging 1.00
X0040:Olfr1484 UTSW 19 13586208 missense probably null 0.00
X0040:Olfr1484 UTSW 19 13586209 missense probably damaging 1.00
X0067:Olfr1484 UTSW 19 13586072 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGATCTTACTTGAGTGGACTCTTAC -3'
(R):5'- TCCAGCAACCTTCCTGACTG -3'

Sequencing Primer
(F):5'- ACTTGAGTGGACTCTTACAATCTTC -3'
(R):5'- AGCAACCTTCCTGACTGCATTC -3'
Posted On2019-12-04