Incidental Mutation 'RF002:Gabre'
ID 602597
Institutional Source Beutler Lab
Gene Symbol Gabre
Ensembl Gene ENSMUSG00000031340
Gene Name gamma-aminobutyric acid (GABA) A receptor, subunit epsilon
Synonyms
Accession Numbers
Essential gene? Not available question?
Stock # RF002 (G1)
Quality Score 211.459
Status Not validated
Chromosome X
Chromosomal Location 71300532-71318433 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to CCGGCTA at 71313663 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000066543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064780]
AlphaFold A2AMW3
Predicted Effect probably null
Transcript: ENSMUST00000064780
SMART Domains Protein: ENSMUSP00000066543
Gene: ENSMUSG00000031340

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 40 55 N/A INTRINSIC
low complexity region 83 169 N/A INTRINSIC
low complexity region 173 219 N/A INTRINSIC
low complexity region 234 441 N/A INTRINSIC
Pfam:Neur_chan_LBD 482 688 1.4e-47 PFAM
Pfam:Neur_chan_memb 695 856 2.1e-23 PFAM
transmembrane domain 892 914 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 CGG CGGTGG 19: 5,475,262 (GRCm39) probably benign Het
AI837181 GGC GGCTGC 19: 5,475,263 (GRCm39) probably benign Het
Angptl1 A T 1: 156,684,794 (GRCm39) Q321L possibly damaging Het
AY358078 T TAGGATAATGC 14: 52,043,050 (GRCm39) probably null Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTGCTCCTCCTCCTCCTCCTCCTCCT 7: 80,162,653 (GRCm39) probably benign Het
Blm CTC CTCATCCTCCTCATC 7: 80,162,675 (GRCm39) probably benign Het
Car13 T C 3: 14,719,974 (GRCm39) Y129H probably damaging Het
Cd109 TTATTTATTTAT TTATTTATTTATGTATTTATTTAT 9: 78,619,805 (GRCm39) probably benign Het
Cd109 TATTTAT TATTTATTTATTCATTTAT 9: 78,619,810 (GRCm39) probably benign Het
Cdh26 T C 2: 178,108,424 (GRCm39) C341R probably damaging Het
Chga GCA GCACCA 12: 102,527,680 (GRCm39) probably benign Het
Col11a1 A T 3: 114,010,650 (GRCm39) I1689L unknown Het
Dnah6 T G 6: 73,078,872 (GRCm39) S2364R probably benign Het
E4f1 CCG CCGACG 17: 24,674,160 (GRCm39) probably benign Het
Fah A C 7: 84,238,836 (GRCm39) N336K probably damaging Het
Fbxo11 A T 17: 88,303,481 (GRCm39) I664K Het
Fcgbp A G 7: 27,789,180 (GRCm39) D582G probably benign Het
Garin5a CCTGGGTCTGAGGGAGGA CCTGGGTCTGAGGGAGGAAGGCTGGATCCTGGATAACTGGGTCTGAGGGAGGA 7: 44,149,944 (GRCm39) probably null Het
Gm1110 A G 9: 26,831,936 (GRCm39) Y72H probably damaging Het
Inpp5e C T 2: 26,298,389 (GRCm39) A71T possibly damaging Het
Iqcm C T 8: 76,304,527 (GRCm39) T96I probably benign Het
Lce1m TGCCACCGCTGC TGCCACCGCTGCCGCCACCGCTGC 3: 92,925,590 (GRCm39) probably benign Het
Lce1m AC ACCGCCGCTGCCCC 3: 92,925,606 (GRCm39) probably benign Het
Lrch1 TTGGTGGTGCTGGTGG TTGGTGG 14: 75,185,014 (GRCm39) probably benign Het
Lyst A G 13: 13,808,948 (GRCm39) D206G probably benign Het
Map4k5 A T 12: 69,903,630 (GRCm39) D58E probably damaging Het
Mapkapk2 A G 1: 130,984,250 (GRCm39) S251P probably damaging Het
Mcph1 CCTG CCTGCTG 8: 18,702,545 (GRCm39) probably benign Het
Men1 T C 19: 6,390,146 (GRCm39) S600P probably damaging Het
Mllt1 C T 17: 57,203,300 (GRCm39) V394M probably benign Het
Mllt1 C A 17: 57,203,301 (GRCm39) M393I possibly damaging Het
Nacc1 T C 8: 85,402,848 (GRCm39) E315G possibly damaging Het
Nefh GGGGACTTGGCCTC GGGGACTTGGCCTCACCTAGGGACTTGGCCTC 11: 4,891,047 (GRCm39) probably benign Het
Nefh GACTTGGCCTC GACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,891,050 (GRCm39) probably benign Het
Nid2 TAACACCGCCA TA 14: 19,801,434 (GRCm39) probably benign Het
Or5b122 T A 19: 13,563,415 (GRCm39) I206N probably damaging Het
Parp2 A G 14: 51,054,843 (GRCm39) E262G probably damaging Het
Pdik1l TTT TTTGTTTTTGTGTT 4: 134,006,686 (GRCm39) probably null Het
Pop1 G A 15: 34,502,583 (GRCm39) G90D probably damaging Het
Ppp3cc T C 14: 70,504,788 (GRCm39) T73A possibly damaging Het
Prdm15 C T 16: 97,600,829 (GRCm39) D810N probably damaging Het
Prpf4b T A 13: 35,068,219 (GRCm39) S349R unknown Het
Rassf6 TCCTGTAGAGCAATGGGGATTC TCCTGTAGAGCAATGGGGATTCTGCCTCACTCATGGGCCTGTAGAGCAATGGGGATTC 5: 90,756,780 (GRCm39) probably benign Het
Rassf6 GTAGAGCAATGGGGATTC GTAGAGCAATGGGGATTCTGCCTCACTCATGGTCCTTTAGAGCAATGGGGATTC 5: 90,756,784 (GRCm39) probably null Het
Sdk2 T C 11: 113,776,078 (GRCm39) E208G probably benign Het
Smurf2 G T 11: 106,743,413 (GRCm39) P211Q probably benign Het
Snx25 C A 8: 46,569,218 (GRCm39) probably null Het
Spata6 T A 4: 111,685,502 (GRCm39) M469K probably benign Het
Spta1 G T 1: 174,058,926 (GRCm39) A1954S possibly damaging Het
Sry CTGGTCGTGGAACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGTGGTGGTCATGGAACTGCTG CTGGTCATGGAACTGCTG Y: 2,662,564 (GRCm39) probably benign Het
Stard8 GAG GAGTAG X: 98,110,121 (GRCm39) probably null Het
Tfeb AGC AGCGGC 17: 48,097,027 (GRCm39) probably benign Het
Tlcd1 T A 11: 78,071,020 (GRCm39) L203Q probably benign Het
Tlr11 T C 14: 50,598,682 (GRCm39) F223L possibly damaging Het
Usp48 T A 4: 137,333,106 (GRCm39) V100D probably damaging Het
Vinac1 A G 2: 128,880,714 (GRCm39) F404S Het
Vmn2r56 G A 7: 12,428,757 (GRCm39) T503I probably benign Het
Vps18 T C 2: 119,127,871 (GRCm39) L898P probably damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,013,434 (GRCm39) probably benign Het
Zfp706 T A 15: 37,003,949 (GRCm39) Y39F probably benign Het
Zhx3 T A 2: 160,623,726 (GRCm39) N147I probably damaging Het
Other mutations in Gabre
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02176:Gabre APN X 71,318,259 (GRCm39) nonsense probably null
FR4304:Gabre UTSW X 71,313,648 (GRCm39) small insertion probably benign
FR4589:Gabre UTSW X 71,313,648 (GRCm39) small insertion probably benign
FR4589:Gabre UTSW X 71,313,636 (GRCm39) small insertion probably benign
FR4976:Gabre UTSW X 71,314,028 (GRCm39) small insertion probably benign
FR4976:Gabre UTSW X 71,314,024 (GRCm39) small insertion probably benign
R7620:Gabre UTSW X 71,313,865 (GRCm39) missense unknown
RF005:Gabre UTSW X 71,313,651 (GRCm39) nonsense probably null
RF009:Gabre UTSW X 71,314,319 (GRCm39) small insertion probably benign
RF009:Gabre UTSW X 71,314,318 (GRCm39) small deletion probably benign
RF010:Gabre UTSW X 71,313,666 (GRCm39) small insertion probably benign
RF013:Gabre UTSW X 71,314,022 (GRCm39) small insertion probably benign
RF023:Gabre UTSW X 71,313,660 (GRCm39) small insertion probably benign
RF024:Gabre UTSW X 71,313,783 (GRCm39) frame shift probably null
RF028:Gabre UTSW X 71,314,369 (GRCm39) small insertion probably benign
RF029:Gabre UTSW X 71,313,665 (GRCm39) small insertion probably benign
RF034:Gabre UTSW X 71,314,368 (GRCm39) small insertion probably benign
RF037:Gabre UTSW X 71,313,667 (GRCm39) small insertion probably benign
RF041:Gabre UTSW X 71,313,655 (GRCm39) small insertion probably benign
RF042:Gabre UTSW X 71,313,653 (GRCm39) small insertion probably benign
RF043:Gabre UTSW X 71,313,654 (GRCm39) small insertion probably benign
RF044:Gabre UTSW X 71,313,667 (GRCm39) small insertion probably benign
RF045:Gabre UTSW X 71,313,787 (GRCm39) frame shift probably null
RF045:Gabre UTSW X 71,313,651 (GRCm39) small insertion probably benign
RF047:Gabre UTSW X 71,314,371 (GRCm39) nonsense probably null
RF047:Gabre UTSW X 71,313,659 (GRCm39) small insertion probably benign
RF049:Gabre UTSW X 71,313,883 (GRCm39) frame shift probably null
RF050:Gabre UTSW X 71,314,347 (GRCm39) nonsense probably null
RF051:Gabre UTSW X 71,313,655 (GRCm39) small insertion probably benign
RF052:Gabre UTSW X 71,313,653 (GRCm39) small insertion probably benign
RF054:Gabre UTSW X 71,314,022 (GRCm39) small insertion probably benign
RF055:Gabre UTSW X 71,313,783 (GRCm39) frame shift probably null
RF058:Gabre UTSW X 71,313,669 (GRCm39) small insertion probably benign
RF059:Gabre UTSW X 71,314,370 (GRCm39) small insertion probably benign
RF061:Gabre UTSW X 71,313,654 (GRCm39) small insertion probably benign
RF064:Gabre UTSW X 71,313,669 (GRCm39) nonsense probably null
RF064:Gabre UTSW X 71,313,777 (GRCm39) frame shift probably null
X0018:Gabre UTSW X 71,313,944 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GGACTGGGGCTCTGATTTCAT -3'
(R):5'- CTCAGCCTCAGCCTCTGG -3'

Sequencing Primer
(F):5'- ACTGGGGCTCTGATTTCATCTCTG -3'
(R):5'- TCAGCCTGAGCCACAGC -3'
Posted On 2019-12-04