Incidental Mutation 'RF003:Etl4'
ID 602604
Institutional Source Beutler Lab
Gene Symbol Etl4
Ensembl Gene ENSMUSG00000036617
Gene Name enhancer trap locus 4
Synonyms 6620402G01Rik, 9430077C05Rik, Skt, Sickle tail, E330027G05Rik, Etl-4
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.756) question?
Stock # RF003 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 19909780-20810713 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 20519918 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 21 (Q21*)
Ref Sequence ENSEMBL: ENSMUSP00000041431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045555] [ENSMUST00000066509] [ENSMUST00000114604] [ENSMUST00000114610] [ENSMUST00000114614] [ENSMUST00000114627] [ENSMUST00000131714] [ENSMUST00000146881]
AlphaFold A2AQ25
Predicted Effect probably null
Transcript: ENSMUST00000045555
AA Change: Q21*
SMART Domains Protein: ENSMUSP00000041431
Gene: ENSMUSG00000036617
AA Change: Q21*

Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 620 652 N/A INTRINSIC
low complexity region 1067 1096 N/A INTRINSIC
low complexity region 1212 1231 N/A INTRINSIC
low complexity region 1296 1314 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066509
AA Change: Q21*
SMART Domains Protein: ENSMUSP00000066170
Gene: ENSMUSG00000036617
AA Change: Q21*

low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 655 687 N/A INTRINSIC
low complexity region 1102 1131 N/A INTRINSIC
low complexity region 1372 1381 N/A INTRINSIC
low complexity region 1470 1495 N/A INTRINSIC
low complexity region 1571 1582 N/A INTRINSIC
coiled coil region 1658 1686 N/A INTRINSIC
low complexity region 1724 1737 N/A INTRINSIC
low complexity region 1806 1825 N/A INTRINSIC
low complexity region 1890 1908 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114604
AA Change: Q21*
SMART Domains Protein: ENSMUSP00000110251
Gene: ENSMUSG00000036617
AA Change: Q21*

Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 655 687 N/A INTRINSIC
low complexity region 1102 1131 N/A INTRINSIC
low complexity region 1207 1226 N/A INTRINSIC
low complexity region 1291 1309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114610
SMART Domains Protein: ENSMUSP00000110257
Gene: ENSMUSG00000036617

Pfam:AIP3 108 211 5e-12 PFAM
low complexity region 233 248 N/A INTRINSIC
low complexity region 270 288 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114614
AA Change: Q21*
SMART Domains Protein: ENSMUSP00000110261
Gene: ENSMUSG00000036617
AA Change: Q21*

Pfam:AIP3 188 291 1.7e-11 PFAM
low complexity region 313 328 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
coiled coil region 620 652 N/A INTRINSIC
low complexity region 1056 1085 N/A INTRINSIC
low complexity region 1201 1220 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114627
SMART Domains Protein: ENSMUSP00000110274
Gene: ENSMUSG00000036617

low complexity region 21 38 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
Pfam:AIP3 239 341 2.4e-14 PFAM
low complexity region 364 379 N/A INTRINSIC
low complexity region 401 419 N/A INTRINSIC
Pfam:AIP3 600 841 1.1e-12 PFAM
low complexity region 1153 1182 N/A INTRINSIC
low complexity region 1423 1432 N/A INTRINSIC
low complexity region 1521 1546 N/A INTRINSIC
low complexity region 1622 1633 N/A INTRINSIC
coiled coil region 1709 1737 N/A INTRINSIC
low complexity region 1775 1788 N/A INTRINSIC
low complexity region 1857 1876 N/A INTRINSIC
low complexity region 1941 1959 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131714
SMART Domains Protein: ENSMUSP00000116637
Gene: ENSMUSG00000036617

low complexity region 18 35 N/A INTRINSIC
low complexity region 57 69 N/A INTRINSIC
Blast:THAP 137 167 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000146881
SMART Domains Protein: ENSMUSP00000119778
Gene: ENSMUSG00000036617

low complexity region 21 38 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
Blast:THAP 140 170 6e-6 BLAST
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trapped allele display malformations of the notochord and caudal vertebrae and may exhibit caudal tail kinks. Mice homozygous for another gene-trapped allele have malformed caudal vertebrae and intervertebral disk abnormalities; about half display kinked tails. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik AACC A 7: 40,993,055 probably benign Het
A630073D07Rik A C 6: 132,627,443 L13R unknown Het
Alg9 GGC GGCCGC 9: 50,775,427 probably benign Het
Arc G C 15: 74,672,131 T81S probably benign Het
Atad5 A T 11: 80,111,560 K1059N probably damaging Het
Bdp1 C A 13: 100,060,449 V1143F probably benign Het
Bdp1 C A 13: 100,060,450 Q1142H probably benign Het
Ccdc33 T C 9: 58,058,291 S583G probably benign Het
Cd109 TTAT TTATTTATTTATATAT 9: 78,712,531 probably benign Het
Cep192 A T 18: 67,837,956 R1009S probably benign Het
Clvs2 T A 10: 33,622,925 H3L probably damaging Het
Cnot6 T C 11: 49,702,613 M14V probably benign Het
Colec10 A G 15: 54,462,391 R206G possibly damaging Het
Dennd6a T C 14: 26,629,534 I598T probably damaging Het
Dmrt2 T C 19: 25,678,134 S366P probably damaging Het
Efhb T C 17: 53,400,891 D748G probably damaging Het
Fam172a A T 13: 77,834,675 I135L possibly damaging Het
Fam71e1 C CGGAGGGAGGAAGGCTGGATCCTGGATACCTGGGTA 7: 44,500,527 probably null Het
Fmn1 ACCTCC ACCTCCCCCTCC 2: 113,525,786 probably benign Het
Fsip2 T A 2: 82,991,521 M5866K probably benign Het
Gab3 CTT CTTATT X: 75,000,006 probably null Het
Gnl2 T A 4: 125,043,725 probably null Het
Grip2 C T 6: 91,783,593 R341Q probably benign Het
Hmcn1 T A 1: 150,624,561 H3960L probably damaging Het
Igkv6-25 T A 6: 70,215,778 Y56* probably null Het
Il12a A T 3: 68,695,229 T102S probably benign Het
Il1a T A 2: 129,302,932 I189F possibly damaging Het
Inpp4b T A 8: 81,969,521 Y361* probably null Het
Las1l AGTGG AGTGGTGG X: 95,940,816 probably benign Het
Lrmp AGCACATTG AGCACATTGTGCACATTG 6: 145,173,783 probably benign Het
Lrrc8d T C 5: 105,812,641 Y306H probably damaging Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Map1b G T 13: 99,430,750 A1821E unknown Het
Maz A G 7: 127,025,497 C284R probably damaging Het
Med23 A G 10: 24,903,785 H920R probably damaging Het
Mmp14 C T 14: 54,439,014 R339* probably null Het
Mroh9 T G 1: 163,058,061 K334T probably damaging Het
Nab1 A T 1: 52,479,282 C320S probably damaging Het
Noto T C 6: 85,424,210 S74P probably benign Het
Nudt4 T C 10: 95,549,374 N152D possibly damaging Het
Nup155 T TTTTG 15: 8,119,176 probably benign Het
Olfr118 A C 17: 37,672,858 K278N probably damaging Het
Olfr330 CA C 11: 58,529,157 probably null Het
Olfr461 T C 6: 40,544,362 I206V probably benign Het
Olfr585 GTTAT GTTATTAT 7: 103,098,305 Het
Olfr585 TTA TTAGTA 7: 103,098,306 probably null Het
Olfr710 T A 7: 106,944,648 M118L probably damaging Het
Olfr828 T C 9: 18,815,482 T271A probably benign Het
Plxnc1 T C 10: 94,794,444 Y1531C probably damaging Het
Pnmal2 TGA TGAAGA 7: 16,946,016 probably benign Het
Rp1 A G 1: 4,344,694 V2065A probably damaging Het
Sepsecs G A 5: 52,647,191 T379M probably benign Het
Sfswap GGCC GGCCCACTCTGCC 5: 129,569,764 probably benign Het
Six3 GCG GCGTCG 17: 85,621,370 probably benign Het
Tfeb C T 17: 47,788,078 T259I possibly damaging Het
Tgoln1 A AAACTCAG 6: 72,616,352 probably null Het
Tmem94 G A 11: 115,796,132 V1108M probably damaging Het
Usp35 T C 7: 97,322,096 K297E possibly damaging Het
Vcpkmt T A 12: 69,582,824 T55S possibly damaging Het
Zfp384 GGCCC GGCCCTGGCCCAAGCCC 6: 125,036,476 probably benign Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,036,483 probably benign Het
Zfp407 A T 18: 84,209,563 S1974T probably benign Het
Zfp677 T C 17: 21,397,442 S254P probably damaging Het
Other mutations in Etl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Etl4 APN 2 20766478 missense possibly damaging 0.81
IGL00944:Etl4 APN 2 20530054 missense possibly damaging 0.52
IGL01078:Etl4 APN 2 20806531 nonsense probably null
IGL01099:Etl4 APN 2 20807111 missense probably benign 0.06
IGL01337:Etl4 APN 2 20785387 missense probably benign 0.01
IGL01348:Etl4 APN 2 20806973 missense probably damaging 1.00
IGL01349:Etl4 APN 2 20713396 missense probably damaging 1.00
IGL01407:Etl4 APN 2 20743856 missense probably damaging 0.99
IGL01552:Etl4 APN 2 20778189 missense probably damaging 0.99
IGL01662:Etl4 APN 2 20806649 missense probably benign 0.04
IGL01687:Etl4 APN 2 20530087 missense probably damaging 1.00
IGL01793:Etl4 APN 2 20743898 missense possibly damaging 0.87
IGL01844:Etl4 APN 2 20806682 missense probably benign 0.06
IGL02025:Etl4 APN 2 20806526 missense probably damaging 1.00
IGL02088:Etl4 APN 2 20806548 missense probably damaging 1.00
IGL02134:Etl4 APN 2 20806429 missense possibly damaging 0.79
IGL02369:Etl4 APN 2 20530189 missense probably damaging 1.00
IGL02480:Etl4 APN 2 20788524 missense probably damaging 0.99
IGL02560:Etl4 APN 2 20743718 missense probably damaging 1.00
IGL02851:Etl4 APN 2 20808029 missense possibly damaging 0.46
IGL02893:Etl4 APN 2 20760210 splice site probably benign
IGL02951:Etl4 APN 2 20801537 splice site probably benign
IGL03119:Etl4 APN 2 20713387 missense probably damaging 1.00
IGL03267:Etl4 APN 2 20785182 nonsense probably null
IGL03379:Etl4 APN 2 20662016 missense possibly damaging 0.87
R0038:Etl4 UTSW 2 20743574 missense probably damaging 1.00
R0038:Etl4 UTSW 2 20743574 missense probably damaging 1.00
R0095:Etl4 UTSW 2 20743868 missense probably damaging 1.00
R0100:Etl4 UTSW 2 20339905 missense probably benign
R0311:Etl4 UTSW 2 20807129 missense probably damaging 1.00
R0346:Etl4 UTSW 2 20759652 critical splice donor site probably null
R0348:Etl4 UTSW 2 20778129 missense probably damaging 1.00
R0379:Etl4 UTSW 2 20807354 missense probably damaging 0.98
R0571:Etl4 UTSW 2 20743769 missense probably damaging 0.99
R0697:Etl4 UTSW 2 20743861 missense probably damaging 1.00
R0707:Etl4 UTSW 2 20805571 splice site probably benign
R0980:Etl4 UTSW 2 20801567 missense probably damaging 1.00
R1120:Etl4 UTSW 2 20806703 missense probably benign 0.00
R1254:Etl4 UTSW 2 20807923 missense probably damaging 1.00
R1346:Etl4 UTSW 2 20806144 missense possibly damaging 0.94
R1460:Etl4 UTSW 2 20788477 missense probably damaging 1.00
R1503:Etl4 UTSW 2 20743874 missense possibly damaging 0.94
R1547:Etl4 UTSW 2 20785228 missense probably damaging 1.00
R1627:Etl4 UTSW 2 20801579 missense possibly damaging 0.91
R1635:Etl4 UTSW 2 20806408 missense probably damaging 1.00
R1716:Etl4 UTSW 2 20743681 missense probably damaging 1.00
R1795:Etl4 UTSW 2 20808026 critical splice donor site probably null
R1885:Etl4 UTSW 2 20743984 missense probably damaging 1.00
R2039:Etl4 UTSW 2 20785228 missense probably damaging 1.00
R2083:Etl4 UTSW 2 20743549 missense probably damaging 1.00
R2109:Etl4 UTSW 2 20785342 missense probably benign 0.27
R2153:Etl4 UTSW 2 20798734 missense probably benign 0.00
R2403:Etl4 UTSW 2 20807306 nonsense probably null
R2883:Etl4 UTSW 2 20806174 missense possibly damaging 0.83
R2985:Etl4 UTSW 2 20781849 missense probably damaging 1.00
R3402:Etl4 UTSW 2 20781882 missense probably damaging 1.00
R3696:Etl4 UTSW 2 20801662 critical splice donor site probably null
R3755:Etl4 UTSW 2 20743537 missense probably benign 0.10
R3813:Etl4 UTSW 2 20788435 missense probably damaging 1.00
R3829:Etl4 UTSW 2 20785421 missense probably benign 0.07
R3887:Etl4 UTSW 2 20529961 nonsense probably null
R3888:Etl4 UTSW 2 20529961 nonsense probably null
R3889:Etl4 UTSW 2 20529961 nonsense probably null
R3958:Etl4 UTSW 2 20340043 missense probably benign
R3959:Etl4 UTSW 2 20340043 missense probably benign
R3960:Etl4 UTSW 2 20340043 missense probably benign
R4058:Etl4 UTSW 2 20806019 missense possibly damaging 0.59
R4074:Etl4 UTSW 2 20809219 utr 3 prime probably benign
R4077:Etl4 UTSW 2 20807961 missense probably damaging 1.00
R4078:Etl4 UTSW 2 20807961 missense probably damaging 1.00
R4127:Etl4 UTSW 2 20744075 missense possibly damaging 0.93
R4200:Etl4 UTSW 2 20781883 missense probably damaging 1.00
R4492:Etl4 UTSW 2 20806865 missense possibly damaging 0.67
R4514:Etl4 UTSW 2 20661898 missense probably damaging 1.00
R4820:Etl4 UTSW 2 20806685 missense possibly damaging 0.85
R4825:Etl4 UTSW 2 20806927 missense probably damaging 1.00
R4888:Etl4 UTSW 2 20340111 critical splice donor site probably null
R4938:Etl4 UTSW 2 20798649 missense probably benign 0.00
R4943:Etl4 UTSW 2 20807281 missense probably benign 0.05
R5121:Etl4 UTSW 2 20340111 critical splice donor site probably null
R5191:Etl4 UTSW 2 20339999 missense probably damaging 0.99
R5198:Etl4 UTSW 2 20713387 missense probably damaging 1.00
R5199:Etl4 UTSW 2 20744042 missense probably damaging 1.00
R5470:Etl4 UTSW 2 20529980 missense probably damaging 0.99
R5513:Etl4 UTSW 2 20743827 missense probably damaging 1.00
R5620:Etl4 UTSW 2 20530226 missense probably damaging 1.00
R5635:Etl4 UTSW 2 20807035 missense probably damaging 1.00
R5641:Etl4 UTSW 2 20806462 frame shift probably null
R5690:Etl4 UTSW 2 20805836 missense probably benign 0.01
R5784:Etl4 UTSW 2 20806205 missense possibly damaging 0.79
R5794:Etl4 UTSW 2 20806512 missense probably damaging 1.00
R5908:Etl4 UTSW 2 20743907 missense probably damaging 0.96
R5982:Etl4 UTSW 2 20781015 missense probably damaging 1.00
R6151:Etl4 UTSW 2 20713360 missense probably damaging 1.00
R6192:Etl4 UTSW 2 20801551 missense probably damaging 0.98
R6238:Etl4 UTSW 2 20801568 missense probably damaging 1.00
R6248:Etl4 UTSW 2 20809089 missense possibly damaging 0.90
R6292:Etl4 UTSW 2 20743573 missense probably damaging 1.00
R6610:Etl4 UTSW 2 20713369 missense probably damaging 1.00
R6739:Etl4 UTSW 2 20713435 missense probably damaging 1.00
R6846:Etl4 UTSW 2 20744108 missense possibly damaging 0.94
R6863:Etl4 UTSW 2 20806309 missense probably benign 0.01
R6873:Etl4 UTSW 2 20797992 splice site probably null
R7003:Etl4 UTSW 2 20805884 missense probably benign 0.03
R7155:Etl4 UTSW 2 20806931 missense probably damaging 0.96
R7207:Etl4 UTSW 2 20709576 missense probably damaging 0.99
R7230:Etl4 UTSW 2 20797988 missense probably damaging 1.00
R7305:Etl4 UTSW 2 20709557 missense probably damaging 1.00
R7389:Etl4 UTSW 2 20785093 nonsense probably null
R7396:Etl4 UTSW 2 20798638 missense possibly damaging 0.62
R7441:Etl4 UTSW 2 20744189 missense possibly damaging 0.87
R7626:Etl4 UTSW 2 20713378 missense probably damaging 1.00
R7776:Etl4 UTSW 2 20807146 missense probably damaging 0.99
R7779:Etl4 UTSW 2 20709477 missense probably damaging 1.00
R7798:Etl4 UTSW 2 20781946 critical splice donor site probably null
R7851:Etl4 UTSW 2 20744140 missense probably damaging 1.00
R7861:Etl4 UTSW 2 20805910 missense probably benign
R7901:Etl4 UTSW 2 20290010 missense possibly damaging 0.83
R8053:Etl4 UTSW 2 20661963 missense probably damaging 1.00
R8124:Etl4 UTSW 2 20806640 missense probably benign 0.06
R8133:Etl4 UTSW 2 20806271 missense possibly damaging 0.86
R8203:Etl4 UTSW 2 20785105 missense possibly damaging 0.61
R8238:Etl4 UTSW 2 20806531 nonsense probably null
R8263:Etl4 UTSW 2 20744154 missense probably benign 0.00
R8299:Etl4 UTSW 2 20744063 missense possibly damaging 0.81
R8318:Etl4 UTSW 2 20788530 missense probably damaging 1.00
R8334:Etl4 UTSW 2 20781046 missense probably damaging 0.96
R8443:Etl4 UTSW 2 20806166 missense probably benign 0.04
R8525:Etl4 UTSW 2 20530081 missense probably damaging 1.00
R8679:Etl4 UTSW 2 20709477 missense probably damaging 1.00
R8918:Etl4 UTSW 2 20743922 missense probably benign
R8918:Etl4 UTSW 2 20806435 missense probably benign 0.00
R9062:Etl4 UTSW 2 20743805 missense probably damaging 0.99
R9095:Etl4 UTSW 2 20778153 missense probably damaging 1.00
R9200:Etl4 UTSW 2 20781891 missense probably damaging 1.00
R9416:Etl4 UTSW 2 20743973 missense probably benign 0.17
R9437:Etl4 UTSW 2 20809061 missense probably benign 0.20
R9451:Etl4 UTSW 2 20809115 missense probably benign 0.03
X0018:Etl4 UTSW 2 20809190 missense probably damaging 0.98
X0022:Etl4 UTSW 2 20709564 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04