Mutagenetix > Incidental Mutations

Incidental Mutation 'RF003:Etl4'

602604

Institutional Source

Beutler Lab

Gene Symbol

Etl4

Ensembl Gene

ENSMUSG00000036617

Gene Name

enhancer trap locus 4

Synonyms

6620402G01Rik, 9430077C05Rik, Skt, Sickle tail, E330027G05Rik, Etl-4

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.756) question?

Stock #

RF003 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

19909780-20810713 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 20519918 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 21 (Q21*)

Ref Sequence

ENSEMBL: ENSMUSP00000041431 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045555] [ENSMUST00000066509] [ENSMUST00000114604] [ENSMUST00000114610] [ENSMUST00000114614] [ENSMUST00000114627] [ENSMUST00000131714] [ENSMUST00000146881]

AlphaFold

A2AQ25

Predicted Effect

probably null
Transcript: ENSMUST00000045555
AA Change: Q21*

SMART Domains

Protein: ENSMUSP00000041431
Gene: ENSMUSG00000036617
AA Change: Q21*

Domain	Start	End	E-Value	Type
Pfam:AIP3	188	291	1.7e-11	PFAM
low complexity region	313	328	N/A	INTRINSIC
low complexity region	350	368	N/A	INTRINSIC
coiled coil region	620	652	N/A	INTRINSIC
low complexity region	1067	1096	N/A	INTRINSIC
low complexity region	1212	1231	N/A	INTRINSIC
low complexity region	1296	1314	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000066509
AA Change: Q21*

SMART Domains

Protein: ENSMUSP00000066170
Gene: ENSMUSG00000036617
AA Change: Q21*

Domain	Start	End	E-Value	Type
low complexity region	313	328	N/A	INTRINSIC
low complexity region	350	368	N/A	INTRINSIC
coiled coil region	655	687	N/A	INTRINSIC
low complexity region	1102	1131	N/A	INTRINSIC
low complexity region	1372	1381	N/A	INTRINSIC
low complexity region	1470	1495	N/A	INTRINSIC
low complexity region	1571	1582	N/A	INTRINSIC
coiled coil region	1658	1686	N/A	INTRINSIC
low complexity region	1724	1737	N/A	INTRINSIC
low complexity region	1806	1825	N/A	INTRINSIC
low complexity region	1890	1908	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000114604
AA Change: Q21*

SMART Domains

Protein: ENSMUSP00000110251
Gene: ENSMUSG00000036617
AA Change: Q21*

Domain	Start	End	E-Value	Type
Pfam:AIP3	188	291	1.7e-11	PFAM
low complexity region	313	328	N/A	INTRINSIC
low complexity region	350	368	N/A	INTRINSIC
coiled coil region	655	687	N/A	INTRINSIC
low complexity region	1102	1131	N/A	INTRINSIC
low complexity region	1207	1226	N/A	INTRINSIC
low complexity region	1291	1309	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114610

SMART Domains

Protein: ENSMUSP00000110257
Gene: ENSMUSG00000036617

Domain	Start	End	E-Value	Type
Pfam:AIP3	108	211	5e-12	PFAM
low complexity region	233	248	N/A	INTRINSIC
low complexity region	270	288	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000114614
AA Change: Q21*

SMART Domains

Protein: ENSMUSP00000110261
Gene: ENSMUSG00000036617
AA Change: Q21*

Domain	Start	End	E-Value	Type
Pfam:AIP3	188	291	1.7e-11	PFAM
low complexity region	313	328	N/A	INTRINSIC
low complexity region	350	368	N/A	INTRINSIC
coiled coil region	620	652	N/A	INTRINSIC
low complexity region	1056	1085	N/A	INTRINSIC
low complexity region	1201	1220	N/A	INTRINSIC
low complexity region	1285	1303	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114627

SMART Domains

Protein: ENSMUSP00000110274
Gene: ENSMUSG00000036617

Domain	Start	End	E-Value	Type
low complexity region	21	38	N/A	INTRINSIC
low complexity region	60	72	N/A	INTRINSIC
Pfam:AIP3	239	341	2.4e-14	PFAM
low complexity region	364	379	N/A	INTRINSIC
low complexity region	401	419	N/A	INTRINSIC
Pfam:AIP3	600	841	1.1e-12	PFAM
low complexity region	1153	1182	N/A	INTRINSIC
low complexity region	1423	1432	N/A	INTRINSIC
low complexity region	1521	1546	N/A	INTRINSIC
low complexity region	1622	1633	N/A	INTRINSIC
coiled coil region	1709	1737	N/A	INTRINSIC
low complexity region	1775	1788	N/A	INTRINSIC
low complexity region	1857	1876	N/A	INTRINSIC
low complexity region	1941	1959	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000131714

SMART Domains

Protein: ENSMUSP00000116637
Gene: ENSMUSG00000036617

Domain	Start	End	E-Value	Type
low complexity region	18	35	N/A	INTRINSIC
low complexity region	57	69	N/A	INTRINSIC
Blast:THAP	137	167	3e-6	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000146881

SMART Domains

Protein: ENSMUSP00000119778
Gene: ENSMUSG00000036617

Domain	Start	End	E-Value	Type
low complexity region	21	38	N/A	INTRINSIC
low complexity region	60	72	N/A	INTRINSIC
Blast:THAP	140	170	6e-6	BLAST

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 99.2%
20x: 98.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene-trapped allele display malformations of the notochord and caudal vertebrae and may exhibit caudal tail kinks. Mice homozygous for another gene-trapped allele have malformed caudal vertebrae and intervertebral disk abnormalities; about half display kinked tails. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	AACC	A	7: 40,993,055		probably benign	Het
A630073D07Rik	A	C	6: 132,627,443	L13R	unknown	Het
Alg9	GGC	GGCCGC	9: 50,775,427		probably benign	Het
Arc	G	C	15: 74,672,131	T81S	probably benign	Het
Atad5	A	T	11: 80,111,560	K1059N	probably damaging	Het
Bdp1	C	A	13: 100,060,449	V1143F	probably benign	Het
Bdp1	C	A	13: 100,060,450	Q1142H	probably benign	Het
Ccdc33	T	C	9: 58,058,291	S583G	probably benign	Het
Cd109	TTAT	TTATTTATTTATATAT	9: 78,712,531		probably benign	Het
Cep192	A	T	18: 67,837,956	R1009S	probably benign	Het
Clvs2	T	A	10: 33,622,925	H3L	probably damaging	Het
Cnot6	T	C	11: 49,702,613	M14V	probably benign	Het
Colec10	A	G	15: 54,462,391	R206G	possibly damaging	Het
Dennd6a	T	C	14: 26,629,534	I598T	probably damaging	Het
Dmrt2	T	C	19: 25,678,134	S366P	probably damaging	Het
Dnmt1	AGTTCCTACCTCGTT	AGTTCCTACCTCGTTTTGGGGGCGGAGCACCGTTCCTACCTCGTT	9: 20,910,131		probably null	Het
Efhb	T	C	17: 53,400,891	D748G	probably damaging	Het
Fam172a	A	T	13: 77,834,675	I135L	possibly damaging	Het
Fam71e1	C	CGGAGGGAGGAAGGCTGGATCCTGGATACCTGGGTA	7: 44,500,527		probably null	Het
Flywch1	CCACTCCTGGTGT	CCACTCCTGGTGTGGGGAGGCTACGTACTCACACACTCCTGGTGT	17: 23,762,166		probably null	Het
Fmn1	ACCTCC	ACCTCCCCCTCC	2: 113,525,786		probably benign	Het
Fsip2	T	A	2: 82,991,521	M5866K	probably benign	Het
Gab3	CTT	CTTATT	X: 75,000,006		probably null	Het
Gnl2	T	A	4: 125,043,725		probably null	Het
Grip2	C	T	6: 91,783,593	R341Q	probably benign	Het
Hmcn1	T	A	1: 150,624,561	H3960L	probably damaging	Het
Igkv6-25	T	A	6: 70,215,778	Y56*	probably null	Het
Il12a	A	T	3: 68,695,229	T102S	probably benign	Het
Il1a	T	A	2: 129,302,932	I189F	possibly damaging	Het
Inpp4b	T	A	8: 81,969,521	Y361*	probably null	Het
Iqcf4	CTTTTCCTTTTCCTTTT	CTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCATTTTCCTTTTCCTTTT	9: 106,570,607		probably benign	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,850,378		probably benign	Het
Las1l	AGTGG	AGTGGTGG	X: 95,940,816		probably benign	Het
Lrmp	AGCACATTG	AGCACATTGTGCACATTG	6: 145,173,783		probably benign	Het
Lrrc8d	T	C	5: 105,812,641	Y306H	probably damaging	Het
Mamld1	AGC	AGCCGC	X: 71,118,820		probably benign	Het
Map1a	CTCCAGCTCCAGCTCCAGCTCCA	CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA	2: 121,306,296		probably benign	Het
Map1b	G	T	13: 99,430,750	A1821E	unknown	Het
Maz	A	G	7: 127,025,497	C284R	probably damaging	Het
Med23	A	G	10: 24,903,785	H920R	probably damaging	Het
Megf10	CCAGCAGCAGCAGCAGCAGCAG	CCAGCAGCAGCAGCAGCAG	18: 57,294,027		probably benign	Het
Mmp14	C	T	14: 54,439,014	R339*	probably null	Het
Mroh9	T	G	1: 163,058,061	K334T	probably damaging	Het
Nab1	A	T	1: 52,479,282	C320S	probably damaging	Het
Noto	T	C	6: 85,424,210	S74P	probably benign	Het
Nudt4	T	C	10: 95,549,374	N152D	possibly damaging	Het
Nup155	T	TTTTG	15: 8,119,176		probably benign	Het
Nusap1	AGCTGAGA	AGCTGAGATACACGTTAGCAGTGAGGAGCAGGCTGAGA	2: 119,627,603		probably benign	Het
Olfr118	A	C	17: 37,672,858	K278N	probably damaging	Het
Olfr330	CA	C	11: 58,529,157		probably null	Het
Olfr461	T	C	6: 40,544,362	I206V	probably benign	Het
Olfr585	GTTAT	GTTATTAT	7: 103,098,305			Het
Olfr585	TTA	TTAGTA	7: 103,098,306		probably null	Het
Olfr710	T	A	7: 106,944,648	M118L	probably damaging	Het
Olfr828	T	C	9: 18,815,482	T271A	probably benign	Het
Plxnc1	T	C	10: 94,794,444	Y1531C	probably damaging	Het
Pnmal2	TGA	TGAAGA	7: 16,946,016		probably benign	Het
Rp1	A	G	1: 4,344,694	V2065A	probably damaging	Het
Sbp	AAGATGCTGACAACA	AAGATGCTGACAACAGAGATGCTGACAACA	17: 23,945,369		probably benign	Het
Sepsecs	G	A	5: 52,647,191	T379M	probably benign	Het
Sfswap	GGCC	GGCCCACTCTGCC	5: 129,569,764		probably benign	Het
Six3	GCG	GCGTCG	17: 85,621,370		probably benign	Het
Tfeb	C	T	17: 47,788,078	T259I	possibly damaging	Het
Tgoln1	A	AAACTCAG	6: 72,616,352		probably null	Het
Tmem94	G	A	11: 115,796,132	V1108M	probably damaging	Het
Usp35	T	C	7: 97,322,096	K297E	possibly damaging	Het
Vcpkmt	T	A	12: 69,582,824	T55S	possibly damaging	Het
Zfp384	GCCCAGGCCCAGGCCCAGGCCCAG	GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG	6: 125,036,471		probably benign	Het
Zfp384	GGCCC	GGCCCTGGCCCAAGCCC	6: 125,036,476		probably benign	Het
Zfp384	GCCCAGGCCCAG	GCCCAGGCCCAGTCCCAGGCCCAG	6: 125,036,483		probably benign	Het
Zfp407	A	T	18: 84,209,563	S1974T	probably benign	Het
Zfp677	T	C	17: 21,397,442	S254P	probably damaging	Het

Other mutations in Etl4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00907:Etl4	APN	2	20766478	missense	possibly damaging	0.81
IGL00944:Etl4	APN	2	20530054	missense	possibly damaging	0.52
IGL01078:Etl4	APN	2	20806531	nonsense	probably null
IGL01099:Etl4	APN	2	20807111	missense	probably benign	0.06
IGL01337:Etl4	APN	2	20785387	missense	probably benign	0.01
IGL01348:Etl4	APN	2	20806973	missense	probably damaging	1.00
IGL01349:Etl4	APN	2	20713396	missense	probably damaging	1.00
IGL01407:Etl4	APN	2	20743856	missense	probably damaging	0.99
IGL01552:Etl4	APN	2	20778189	missense	probably damaging	0.99
IGL01662:Etl4	APN	2	20806649	missense	probably benign	0.04
IGL01687:Etl4	APN	2	20530087	missense	probably damaging	1.00
IGL01793:Etl4	APN	2	20743898	missense	possibly damaging	0.87
IGL01844:Etl4	APN	2	20806682	missense	probably benign	0.06
IGL02025:Etl4	APN	2	20806526	missense	probably damaging	1.00
IGL02088:Etl4	APN	2	20806548	missense	probably damaging	1.00
IGL02134:Etl4	APN	2	20806429	missense	possibly damaging	0.79
IGL02369:Etl4	APN	2	20530189	missense	probably damaging	1.00
IGL02480:Etl4	APN	2	20788524	missense	probably damaging	0.99
IGL02560:Etl4	APN	2	20743718	missense	probably damaging	1.00
IGL02851:Etl4	APN	2	20808029	missense	possibly damaging	0.46
IGL02893:Etl4	APN	2	20760210	splice site	probably benign
IGL02951:Etl4	APN	2	20801537	splice site	probably benign
IGL03119:Etl4	APN	2	20713387	missense	probably damaging	1.00
IGL03267:Etl4	APN	2	20785182	nonsense	probably null
IGL03379:Etl4	APN	2	20662016	missense	possibly damaging	0.87
R0038:Etl4	UTSW	2	20743574	missense	probably damaging	1.00
R0038:Etl4	UTSW	2	20743574	missense	probably damaging	1.00
R0095:Etl4	UTSW	2	20743868	missense	probably damaging	1.00
R0100:Etl4	UTSW	2	20339905	missense	probably benign
R0311:Etl4	UTSW	2	20807129	missense	probably damaging	1.00
R0346:Etl4	UTSW	2	20759652	critical splice donor site	probably null
R0348:Etl4	UTSW	2	20778129	missense	probably damaging	1.00
R0379:Etl4	UTSW	2	20807354	missense	probably damaging	0.98
R0571:Etl4	UTSW	2	20743769	missense	probably damaging	0.99
R0697:Etl4	UTSW	2	20743861	missense	probably damaging	1.00
R0707:Etl4	UTSW	2	20805571	splice site	probably benign
R0980:Etl4	UTSW	2	20801567	missense	probably damaging	1.00
R1120:Etl4	UTSW	2	20806703	missense	probably benign	0.00
R1254:Etl4	UTSW	2	20807923	missense	probably damaging	1.00
R1346:Etl4	UTSW	2	20806144	missense	possibly damaging	0.94
R1460:Etl4	UTSW	2	20788477	missense	probably damaging	1.00
R1503:Etl4	UTSW	2	20743874	missense	possibly damaging	0.94
R1547:Etl4	UTSW	2	20785228	missense	probably damaging	1.00
R1627:Etl4	UTSW	2	20801579	missense	possibly damaging	0.91
R1635:Etl4	UTSW	2	20806408	missense	probably damaging	1.00
R1716:Etl4	UTSW	2	20743681	missense	probably damaging	1.00
R1795:Etl4	UTSW	2	20808026	critical splice donor site	probably null
R1885:Etl4	UTSW	2	20743984	missense	probably damaging	1.00
R2039:Etl4	UTSW	2	20785228	missense	probably damaging	1.00
R2083:Etl4	UTSW	2	20743549	missense	probably damaging	1.00
R2109:Etl4	UTSW	2	20785342	missense	probably benign	0.27
R2153:Etl4	UTSW	2	20798734	missense	probably benign	0.00
R2403:Etl4	UTSW	2	20807306	nonsense	probably null
R2883:Etl4	UTSW	2	20806174	missense	possibly damaging	0.83
R2985:Etl4	UTSW	2	20781849	missense	probably damaging	1.00
R3402:Etl4	UTSW	2	20781882	missense	probably damaging	1.00
R3696:Etl4	UTSW	2	20801662	critical splice donor site	probably null
R3755:Etl4	UTSW	2	20743537	missense	probably benign	0.10
R3813:Etl4	UTSW	2	20788435	missense	probably damaging	1.00
R3829:Etl4	UTSW	2	20785421	missense	probably benign	0.07
R3887:Etl4	UTSW	2	20529961	nonsense	probably null
R3888:Etl4	UTSW	2	20529961	nonsense	probably null
R3889:Etl4	UTSW	2	20529961	nonsense	probably null
R3958:Etl4	UTSW	2	20340043	missense	probably benign
R3959:Etl4	UTSW	2	20340043	missense	probably benign
R3960:Etl4	UTSW	2	20340043	missense	probably benign
R4058:Etl4	UTSW	2	20806019	missense	possibly damaging	0.59
R4074:Etl4	UTSW	2	20809219	utr 3 prime	probably benign
R4077:Etl4	UTSW	2	20807961	missense	probably damaging	1.00
R4078:Etl4	UTSW	2	20807961	missense	probably damaging	1.00
R4127:Etl4	UTSW	2	20744075	missense	possibly damaging	0.93
R4200:Etl4	UTSW	2	20781883	missense	probably damaging	1.00
R4492:Etl4	UTSW	2	20806865	missense	possibly damaging	0.67
R4514:Etl4	UTSW	2	20661898	missense	probably damaging	1.00
R4820:Etl4	UTSW	2	20806685	missense	possibly damaging	0.85
R4825:Etl4	UTSW	2	20806927	missense	probably damaging	1.00
R4888:Etl4	UTSW	2	20340111	critical splice donor site	probably null
R4938:Etl4	UTSW	2	20798649	missense	probably benign	0.00
R4943:Etl4	UTSW	2	20807281	missense	probably benign	0.05
R5121:Etl4	UTSW	2	20340111	critical splice donor site	probably null
R5191:Etl4	UTSW	2	20339999	missense	probably damaging	0.99
R5198:Etl4	UTSW	2	20713387	missense	probably damaging	1.00
R5199:Etl4	UTSW	2	20744042	missense	probably damaging	1.00
R5470:Etl4	UTSW	2	20529980	missense	probably damaging	0.99
R5513:Etl4	UTSW	2	20743827	missense	probably damaging	1.00
R5620:Etl4	UTSW	2	20530226	missense	probably damaging	1.00
R5635:Etl4	UTSW	2	20807035	missense	probably damaging	1.00
R5641:Etl4	UTSW	2	20806462	frame shift	probably null
R5690:Etl4	UTSW	2	20805836	missense	probably benign	0.01
R5784:Etl4	UTSW	2	20806205	missense	possibly damaging	0.79
R5794:Etl4	UTSW	2	20806512	missense	probably damaging	1.00
R5908:Etl4	UTSW	2	20743907	missense	probably damaging	0.96
R5982:Etl4	UTSW	2	20781015	missense	probably damaging	1.00
R6151:Etl4	UTSW	2	20713360	missense	probably damaging	1.00
R6192:Etl4	UTSW	2	20801551	missense	probably damaging	0.98
R6238:Etl4	UTSW	2	20801568	missense	probably damaging	1.00
R6248:Etl4	UTSW	2	20809089	missense	possibly damaging	0.90
R6292:Etl4	UTSW	2	20743573	missense	probably damaging	1.00
R6610:Etl4	UTSW	2	20713369	missense	probably damaging	1.00
R6739:Etl4	UTSW	2	20713435	missense	probably damaging	1.00
R6846:Etl4	UTSW	2	20744108	missense	possibly damaging	0.94
R6863:Etl4	UTSW	2	20806309	missense	probably benign	0.01
R6873:Etl4	UTSW	2	20797992	splice site	probably null
R7003:Etl4	UTSW	2	20805884	missense	probably benign	0.03
R7155:Etl4	UTSW	2	20806931	missense	probably damaging	0.96
R7207:Etl4	UTSW	2	20709576	missense	probably damaging	0.99
R7230:Etl4	UTSW	2	20797988	missense	probably damaging	1.00
R7305:Etl4	UTSW	2	20709557	missense	probably damaging	1.00
R7389:Etl4	UTSW	2	20785093	nonsense	probably null
R7396:Etl4	UTSW	2	20798638	missense	possibly damaging	0.62
R7441:Etl4	UTSW	2	20744189	missense	possibly damaging	0.87
R7626:Etl4	UTSW	2	20713378	missense	probably damaging	1.00
R7776:Etl4	UTSW	2	20807146	missense	probably damaging	0.99
R7779:Etl4	UTSW	2	20709477	missense	probably damaging	1.00
R7798:Etl4	UTSW	2	20781946	critical splice donor site	probably null
R7851:Etl4	UTSW	2	20744140	missense	probably damaging	1.00
R7861:Etl4	UTSW	2	20805910	missense	probably benign
R7901:Etl4	UTSW	2	20290010	missense	possibly damaging	0.83
R8053:Etl4	UTSW	2	20661963	missense	probably damaging	1.00
R8124:Etl4	UTSW	2	20806640	missense	probably benign	0.06
R8133:Etl4	UTSW	2	20806271	missense	possibly damaging	0.86
R8203:Etl4	UTSW	2	20785105	missense	possibly damaging	0.61
R8238:Etl4	UTSW	2	20806531	nonsense	probably null
R8263:Etl4	UTSW	2	20744154	missense	probably benign	0.00
R8299:Etl4	UTSW	2	20744063	missense	possibly damaging	0.81
R8318:Etl4	UTSW	2	20788530	missense	probably damaging	1.00
R8334:Etl4	UTSW	2	20781046	missense	probably damaging	0.96
R8443:Etl4	UTSW	2	20806166	missense	probably benign	0.04
R8525:Etl4	UTSW	2	20530081	missense	probably damaging	1.00
R8679:Etl4	UTSW	2	20709477	missense	probably damaging	1.00
R8918:Etl4	UTSW	2	20743922	missense	probably benign
R8918:Etl4	UTSW	2	20806435	missense	probably benign	0.00
R9062:Etl4	UTSW	2	20743805	missense	probably damaging	0.99
R9095:Etl4	UTSW	2	20778153	missense	probably damaging	1.00
R9200:Etl4	UTSW	2	20781891	missense	probably damaging	1.00
R9416:Etl4	UTSW	2	20743973	missense	probably benign	0.17
R9437:Etl4	UTSW	2	20809061	missense	probably benign	0.20
R9451:Etl4	UTSW	2	20809115	missense	probably benign	0.03
X0018:Etl4	UTSW	2	20809190	missense	probably damaging	0.98
X0022:Etl4	UTSW	2	20709564	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCGGAGTGGAGACTAGTTG -3'
(R):5'- TGGGCTCAGTTTGAAAGTACACC -3'

Sequencing Primer
(F):5'- GTGGGGTTTCGCCAGTCC -3'
(R):5'- TCAGTTTGAAAGTACACCCCACC -3'

Posted On

2019-12-04