Incidental Mutation 'RF003:Nusap1'
ID 602607
Institutional Source Beutler Lab
Gene Symbol Nusap1
Ensembl Gene ENSMUSG00000027306
Gene Name nucleolar and spindle associated protein 1
Synonyms 2610201A12Rik, NuSAP
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF003 (G1)
Quality Score 182.468
Status Not validated
Chromosome 2
Chromosomal Location 119449205-119480646 bp(+) (GRCm39)
Type of Mutation small insertion (10 aa in frame mutation)
DNA Base Change (assembly) AGCTGAGA to AGCTGAGATACACGTTAGCAGTGAGGAGCAGGCTGAGA at 119458084 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000068713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028771] [ENSMUST00000068225]
AlphaFold Q9ERH4
Predicted Effect probably benign
Transcript: ENSMUST00000028771
SMART Domains Protein: ENSMUSP00000028771
Gene: ENSMUSG00000027306

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
low complexity region 119 129 N/A INTRINSIC
coiled coil region 360 392 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068225
SMART Domains Protein: ENSMUSP00000068713
Gene: ENSMUSG00000027306

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
low complexity region 119 129 N/A INTRINSIC
Pfam:NUSAP 167 261 6e-27 PFAM
Pfam:NUSAP 256 421 2.3e-72 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NUSAP1 is a nucleolar-spindle-associated protein that plays a role in spindle microtubule organization (Raemaekers et al., 2003 [PubMed 12963707]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Early embryos homozygous for a knock-out allele are small and exhibit disorganized embryonic tissue, abnormal chromatin-induced spindle assembly, abnormal inner cell mass apoptosis, and complete embryonic lethality at implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik AACC A 7: 40,642,479 (GRCm39) probably benign Het
A630073D07Rik A C 6: 132,604,406 (GRCm39) L13R unknown Het
Alg9 GGC GGCCGC 9: 50,686,727 (GRCm39) probably benign Het
Arb2a A T 13: 77,982,794 (GRCm39) I135L possibly damaging Het
Arc G C 15: 74,543,980 (GRCm39) T81S probably benign Het
Atad5 A T 11: 80,002,386 (GRCm39) K1059N probably damaging Het
Bdp1 C A 13: 100,196,957 (GRCm39) V1143F probably benign Het
Bdp1 C A 13: 100,196,958 (GRCm39) Q1142H probably benign Het
Ccdc33 T C 9: 57,965,574 (GRCm39) S583G probably benign Het
Cd109 TTAT TTATTTATTTATATAT 9: 78,619,813 (GRCm39) probably benign Het
Cep192 A T 18: 67,971,027 (GRCm39) R1009S probably benign Het
Clvs2 T A 10: 33,498,921 (GRCm39) H3L probably damaging Het
Cnot6 T C 11: 49,593,440 (GRCm39) M14V probably benign Het
Colec10 A G 15: 54,325,787 (GRCm39) R206G possibly damaging Het
Dennd6a T C 14: 26,350,689 (GRCm39) I598T probably damaging Het
Dmrt2 T C 19: 25,655,498 (GRCm39) S366P probably damaging Het
Dnmt1 AGTTCCTACCTCGTT AGTTCCTACCTCGTTTTGGGGGCGGAGCACCGTTCCTACCTCGTT 9: 20,821,427 (GRCm39) probably null Het
Efhb T C 17: 53,707,919 (GRCm39) D748G probably damaging Het
Etl4 C T 2: 20,524,729 (GRCm39) Q21* probably null Het
Flywch1 CCACTCCTGGTGT CCACTCCTGGTGTGGGGAGGCTACGTACTCACACACTCCTGGTGT 17: 23,981,140 (GRCm39) probably null Het
Fmn1 ACCTCC ACCTCCCCCTCC 2: 113,356,131 (GRCm39) probably benign Het
Fsip2 T A 2: 82,821,865 (GRCm39) M5866K probably benign Het
Gab3 CTT CTTATT X: 74,043,612 (GRCm39) probably null Het
Garin5a C CGGAGGGAGGAAGGCTGGATCCTGGATACCTGGGTA 7: 44,149,951 (GRCm39) probably null Het
Gnl2 T A 4: 124,937,518 (GRCm39) probably null Het
Grip2 C T 6: 91,760,574 (GRCm39) R341Q probably benign Het
Hmcn1 T A 1: 150,500,312 (GRCm39) H3960L probably damaging Het
Igkv6-25 T A 6: 70,192,762 (GRCm39) Y56* probably null Het
Il12a A T 3: 68,602,562 (GRCm39) T102S probably benign Het
Il1a T A 2: 129,144,852 (GRCm39) I189F possibly damaging Het
Inpp4b T A 8: 82,696,150 (GRCm39) Y361* probably null Het
Iqcf4 CTTTTCCTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCATTTTCCTTTTCCTTTT 9: 106,447,806 (GRCm39) probably benign Het
Irag2 AGCACATTG AGCACATTGTGCACATTG 6: 145,119,509 (GRCm39) probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Las1l AGTGG AGTGGTGG X: 94,984,422 (GRCm39) probably benign Het
Lrrc8d T C 5: 105,960,507 (GRCm39) Y306H probably damaging Het
Mamld1 AGC AGCCGC X: 70,162,426 (GRCm39) probably benign Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,136,777 (GRCm39) probably benign Het
Map1b G T 13: 99,567,258 (GRCm39) A1821E unknown Het
Maz A G 7: 126,624,669 (GRCm39) C284R probably damaging Het
Med23 A G 10: 24,779,683 (GRCm39) H920R probably damaging Het
Megf10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 18: 57,427,099 (GRCm39) probably benign Het
Mmp14 C T 14: 54,676,471 (GRCm39) R339* probably null Het
Mroh9 T G 1: 162,885,630 (GRCm39) K334T probably damaging Het
Nab1 A T 1: 52,518,441 (GRCm39) C320S probably damaging Het
Noto T C 6: 85,401,192 (GRCm39) S74P probably benign Het
Nudt4 T C 10: 95,385,236 (GRCm39) N152D possibly damaging Het
Nup155 T TTTTG 15: 8,148,660 (GRCm39) probably benign Het
Or10al2 A C 17: 37,983,749 (GRCm39) K278N probably damaging Het
Or2d4 T A 7: 106,543,855 (GRCm39) M118L probably damaging Het
Or2t48 CA C 11: 58,419,983 (GRCm39) probably null Het
Or51f1e TTA TTAGTA 7: 102,747,513 (GRCm39) probably null Het
Or51f1e GTTAT GTTATTAT 7: 102,747,512 (GRCm39) Het
Or7g16 T C 9: 18,726,778 (GRCm39) T271A probably benign Het
Or9a7 T C 6: 40,521,296 (GRCm39) I206V probably benign Het
Plxnc1 T C 10: 94,630,306 (GRCm39) Y1531C probably damaging Het
Pnma8b TGA TGAAGA 7: 16,679,941 (GRCm39) probably benign Het
Rp1 A G 1: 4,414,917 (GRCm39) V2065A probably damaging Het
Sbp AAGATGCTGACAACA AAGATGCTGACAACAGAGATGCTGACAACA 17: 24,164,343 (GRCm39) probably benign Het
Sepsecs G A 5: 52,804,533 (GRCm39) T379M probably benign Het
Sfswap GGCC GGCCCACTCTGCC 5: 129,646,828 (GRCm39) probably benign Het
Six3 GCG GCGTCG 17: 85,928,798 (GRCm39) probably benign Het
Tfeb C T 17: 48,099,003 (GRCm39) T259I possibly damaging Het
Tgoln1 A AAACTCAG 6: 72,593,335 (GRCm39) probably null Het
Tmem94 G A 11: 115,686,958 (GRCm39) V1108M probably damaging Het
Usp35 T C 7: 96,971,303 (GRCm39) K297E possibly damaging Het
Vcpkmt T A 12: 69,629,598 (GRCm39) T55S possibly damaging Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,013,446 (GRCm39) probably benign Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,013,434 (GRCm39) probably benign Het
Zfp384 GGCCC GGCCCTGGCCCAAGCCC 6: 125,013,439 (GRCm39) probably benign Het
Zfp407 A T 18: 84,227,688 (GRCm39) S1974T probably benign Het
Zfp677 T C 17: 21,617,704 (GRCm39) S254P probably damaging Het
Other mutations in Nusap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02580:Nusap1 APN 2 119,479,371 (GRCm39) splice site probably benign
IGL02582:Nusap1 APN 2 119,479,470 (GRCm39) makesense probably null
IGL02732:Nusap1 APN 2 119,466,061 (GRCm39) missense probably damaging 0.96
IGL02794:Nusap1 APN 2 119,460,867 (GRCm39) missense possibly damaging 0.80
R0635:Nusap1 UTSW 2 119,458,148 (GRCm39) missense probably damaging 0.98
R2567:Nusap1 UTSW 2 119,474,311 (GRCm39) missense possibly damaging 0.70
R3162:Nusap1 UTSW 2 119,460,885 (GRCm39) missense possibly damaging 0.86
R3162:Nusap1 UTSW 2 119,460,885 (GRCm39) missense possibly damaging 0.86
R3895:Nusap1 UTSW 2 119,458,172 (GRCm39) missense possibly damaging 0.94
R4296:Nusap1 UTSW 2 119,470,129 (GRCm39) missense probably damaging 1.00
R5111:Nusap1 UTSW 2 119,460,837 (GRCm39) nonsense probably null
R5417:Nusap1 UTSW 2 119,477,624 (GRCm39) missense probably damaging 0.98
R5754:Nusap1 UTSW 2 119,477,580 (GRCm39) missense probably damaging 1.00
R5818:Nusap1 UTSW 2 119,465,994 (GRCm39) missense possibly damaging 0.85
R6176:Nusap1 UTSW 2 119,460,902 (GRCm39) missense probably benign 0.01
R7947:Nusap1 UTSW 2 119,477,616 (GRCm39) missense possibly damaging 0.95
R9010:Nusap1 UTSW 2 119,479,456 (GRCm39) missense possibly damaging 0.91
R9312:Nusap1 UTSW 2 119,458,119 (GRCm39) small deletion probably benign
R9556:Nusap1 UTSW 2 119,479,444 (GRCm39) missense possibly damaging 0.95
RF007:Nusap1 UTSW 2 119,458,062 (GRCm39) small insertion probably benign
RF010:Nusap1 UTSW 2 119,458,065 (GRCm39) small insertion probably benign
RF016:Nusap1 UTSW 2 119,458,082 (GRCm39) small insertion probably benign
RF018:Nusap1 UTSW 2 119,458,059 (GRCm39) small insertion probably benign
RF026:Nusap1 UTSW 2 119,458,085 (GRCm39) small insertion probably benign
RF026:Nusap1 UTSW 2 119,458,071 (GRCm39) small insertion probably benign
RF028:Nusap1 UTSW 2 119,458,072 (GRCm39) small insertion probably benign
RF028:Nusap1 UTSW 2 119,458,059 (GRCm39) small insertion probably benign
RF029:Nusap1 UTSW 2 119,458,075 (GRCm39) small insertion probably benign
RF029:Nusap1 UTSW 2 119,458,086 (GRCm39) small insertion probably benign
RF032:Nusap1 UTSW 2 119,458,068 (GRCm39) small insertion probably benign
RF033:Nusap1 UTSW 2 119,458,081 (GRCm39) small insertion probably benign
RF035:Nusap1 UTSW 2 119,458,060 (GRCm39) small insertion probably benign
RF036:Nusap1 UTSW 2 119,458,075 (GRCm39) small insertion probably benign
RF036:Nusap1 UTSW 2 119,458,068 (GRCm39) small insertion probably benign
RF037:Nusap1 UTSW 2 119,458,070 (GRCm39) small insertion probably benign
RF040:Nusap1 UTSW 2 119,458,068 (GRCm39) small insertion probably benign
RF041:Nusap1 UTSW 2 119,458,088 (GRCm39) nonsense probably null
RF041:Nusap1 UTSW 2 119,458,074 (GRCm39) small insertion probably benign
RF041:Nusap1 UTSW 2 119,458,060 (GRCm39) small insertion probably benign
RF042:Nusap1 UTSW 2 119,458,088 (GRCm39) nonsense probably null
RF043:Nusap1 UTSW 2 119,458,073 (GRCm39) small insertion probably benign
RF045:Nusap1 UTSW 2 119,458,091 (GRCm39) small insertion probably benign
RF046:Nusap1 UTSW 2 119,458,076 (GRCm39) nonsense probably null
RF048:Nusap1 UTSW 2 119,458,080 (GRCm39) small insertion probably benign
RF049:Nusap1 UTSW 2 119,458,064 (GRCm39) small insertion probably benign
RF052:Nusap1 UTSW 2 119,458,065 (GRCm39) small insertion probably benign
RF056:Nusap1 UTSW 2 119,458,072 (GRCm39) small insertion probably benign
RF056:Nusap1 UTSW 2 119,458,067 (GRCm39) small insertion probably benign
RF056:Nusap1 UTSW 2 119,458,062 (GRCm39) small insertion probably benign
RF062:Nusap1 UTSW 2 119,458,091 (GRCm39) small insertion probably benign
RF062:Nusap1 UTSW 2 119,458,082 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TCGGACCATCCTGTGTTCATAC -3'
(R):5'- GCATGTTTCCAGTCATCTAGC -3'

Sequencing Primer
(F):5'- GGACCATCCTGTGTTCATACTGTAAC -3'
(R):5'- TCCAGTCATCTAGCATCATGAAGG -3'
Posted On 2019-12-04