Incidental Mutation 'RF003:Il12a'
ID 602610
Institutional Source Beutler Lab
Gene Symbol Il12a
Ensembl Gene ENSMUSG00000027776
Gene Name interleukin 12a
Synonyms p35, IL-12p35
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # RF003 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 68597977-68605880 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 68602562 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 102 (T102S)
Ref Sequence ENSEMBL: ENSMUSP00000103446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029345] [ENSMUST00000107816]
AlphaFold P43431
Predicted Effect probably benign
Transcript: ENSMUST00000029345
AA Change: T123S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000029345
Gene: ENSMUSG00000027776
AA Change: T123S

DomainStartEndE-ValueType
low complexity region 1 26 N/A INTRINSIC
Pfam:IL12 27 236 2.5e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107816
AA Change: T102S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000103446
Gene: ENSMUSG00000027776
AA Change: T102S

DomainStartEndE-ValueType
Pfam:IL12 1 215 6.8e-128 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. The cytokine is a disulfide-linked heterodimer composed of the 35-kD subunit encoded by this gene, and a 40-kD subunit that is a member of the cytokine receptor family. This cytokine is required for the T-cell-independent induction of interferon (IFN)-gamma, and is important for the differentiation of both Th1 and Th2 cells. The responses of lymphocytes to this cytokine are mediated by the activator of transcription protein STAT4. Nitric oxide synthase 2A (NOS2A/NOS2) is found to be required for the signaling process of this cytokine in innate immunity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null homozygotes have decreased NK cell responses, altered effector T cell differentiation, and increased susceptibility to parasitic infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik AACC A 7: 40,642,479 (GRCm39) probably benign Het
A630073D07Rik A C 6: 132,604,406 (GRCm39) L13R unknown Het
Alg9 GGC GGCCGC 9: 50,686,727 (GRCm39) probably benign Het
Arb2a A T 13: 77,982,794 (GRCm39) I135L possibly damaging Het
Arc G C 15: 74,543,980 (GRCm39) T81S probably benign Het
Atad5 A T 11: 80,002,386 (GRCm39) K1059N probably damaging Het
Bdp1 C A 13: 100,196,957 (GRCm39) V1143F probably benign Het
Bdp1 C A 13: 100,196,958 (GRCm39) Q1142H probably benign Het
Ccdc33 T C 9: 57,965,574 (GRCm39) S583G probably benign Het
Cd109 TTAT TTATTTATTTATATAT 9: 78,619,813 (GRCm39) probably benign Het
Cep192 A T 18: 67,971,027 (GRCm39) R1009S probably benign Het
Clvs2 T A 10: 33,498,921 (GRCm39) H3L probably damaging Het
Cnot6 T C 11: 49,593,440 (GRCm39) M14V probably benign Het
Colec10 A G 15: 54,325,787 (GRCm39) R206G possibly damaging Het
Dennd6a T C 14: 26,350,689 (GRCm39) I598T probably damaging Het
Dmrt2 T C 19: 25,655,498 (GRCm39) S366P probably damaging Het
Dnmt1 AGTTCCTACCTCGTT AGTTCCTACCTCGTTTTGGGGGCGGAGCACCGTTCCTACCTCGTT 9: 20,821,427 (GRCm39) probably null Het
Efhb T C 17: 53,707,919 (GRCm39) D748G probably damaging Het
Etl4 C T 2: 20,524,729 (GRCm39) Q21* probably null Het
Flywch1 CCACTCCTGGTGT CCACTCCTGGTGTGGGGAGGCTACGTACTCACACACTCCTGGTGT 17: 23,981,140 (GRCm39) probably null Het
Fmn1 ACCTCC ACCTCCCCCTCC 2: 113,356,131 (GRCm39) probably benign Het
Fsip2 T A 2: 82,821,865 (GRCm39) M5866K probably benign Het
Gab3 CTT CTTATT X: 74,043,612 (GRCm39) probably null Het
Garin5a C CGGAGGGAGGAAGGCTGGATCCTGGATACCTGGGTA 7: 44,149,951 (GRCm39) probably null Het
Gnl2 T A 4: 124,937,518 (GRCm39) probably null Het
Grip2 C T 6: 91,760,574 (GRCm39) R341Q probably benign Het
Hmcn1 T A 1: 150,500,312 (GRCm39) H3960L probably damaging Het
Igkv6-25 T A 6: 70,192,762 (GRCm39) Y56* probably null Het
Il1a T A 2: 129,144,852 (GRCm39) I189F possibly damaging Het
Inpp4b T A 8: 82,696,150 (GRCm39) Y361* probably null Het
Iqcf4 CTTTTCCTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCATTTTCCTTTTCCTTTT 9: 106,447,806 (GRCm39) probably benign Het
Irag2 AGCACATTG AGCACATTGTGCACATTG 6: 145,119,509 (GRCm39) probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Las1l AGTGG AGTGGTGG X: 94,984,422 (GRCm39) probably benign Het
Lrrc8d T C 5: 105,960,507 (GRCm39) Y306H probably damaging Het
Mamld1 AGC AGCCGC X: 70,162,426 (GRCm39) probably benign Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,136,777 (GRCm39) probably benign Het
Map1b G T 13: 99,567,258 (GRCm39) A1821E unknown Het
Maz A G 7: 126,624,669 (GRCm39) C284R probably damaging Het
Med23 A G 10: 24,779,683 (GRCm39) H920R probably damaging Het
Megf10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 18: 57,427,099 (GRCm39) probably benign Het
Mmp14 C T 14: 54,676,471 (GRCm39) R339* probably null Het
Mroh9 T G 1: 162,885,630 (GRCm39) K334T probably damaging Het
Nab1 A T 1: 52,518,441 (GRCm39) C320S probably damaging Het
Noto T C 6: 85,401,192 (GRCm39) S74P probably benign Het
Nudt4 T C 10: 95,385,236 (GRCm39) N152D possibly damaging Het
Nup155 T TTTTG 15: 8,148,660 (GRCm39) probably benign Het
Nusap1 AGCTGAGA AGCTGAGATACACGTTAGCAGTGAGGAGCAGGCTGAGA 2: 119,458,084 (GRCm39) probably benign Het
Or10al2 A C 17: 37,983,749 (GRCm39) K278N probably damaging Het
Or2d4 T A 7: 106,543,855 (GRCm39) M118L probably damaging Het
Or2t48 CA C 11: 58,419,983 (GRCm39) probably null Het
Or51f1e GTTAT GTTATTAT 7: 102,747,512 (GRCm39) Het
Or51f1e TTA TTAGTA 7: 102,747,513 (GRCm39) probably null Het
Or7g16 T C 9: 18,726,778 (GRCm39) T271A probably benign Het
Or9a7 T C 6: 40,521,296 (GRCm39) I206V probably benign Het
Plxnc1 T C 10: 94,630,306 (GRCm39) Y1531C probably damaging Het
Pnma8b TGA TGAAGA 7: 16,679,941 (GRCm39) probably benign Het
Rp1 A G 1: 4,414,917 (GRCm39) V2065A probably damaging Het
Sbp AAGATGCTGACAACA AAGATGCTGACAACAGAGATGCTGACAACA 17: 24,164,343 (GRCm39) probably benign Het
Sepsecs G A 5: 52,804,533 (GRCm39) T379M probably benign Het
Sfswap GGCC GGCCCACTCTGCC 5: 129,646,828 (GRCm39) probably benign Het
Six3 GCG GCGTCG 17: 85,928,798 (GRCm39) probably benign Het
Tfeb C T 17: 48,099,003 (GRCm39) T259I possibly damaging Het
Tgoln1 A AAACTCAG 6: 72,593,335 (GRCm39) probably null Het
Tmem94 G A 11: 115,686,958 (GRCm39) V1108M probably damaging Het
Usp35 T C 7: 96,971,303 (GRCm39) K297E possibly damaging Het
Vcpkmt T A 12: 69,629,598 (GRCm39) T55S possibly damaging Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,013,446 (GRCm39) probably benign Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,013,434 (GRCm39) probably benign Het
Zfp384 GGCCC GGCCCTGGCCCAAGCCC 6: 125,013,439 (GRCm39) probably benign Het
Zfp407 A T 18: 84,227,688 (GRCm39) S1974T probably benign Het
Zfp677 T C 17: 21,617,704 (GRCm39) S254P probably damaging Het
Other mutations in Il12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Il12a APN 3 68,598,888 (GRCm39) missense possibly damaging 0.96
IGL01820:Il12a APN 3 68,599,495 (GRCm39) splice site probably benign
IGL01989:Il12a APN 3 68,598,909 (GRCm39) splice site probably benign
bakers_dozen UTSW 3 68,605,320 (GRCm39) frame shift probably null
R0388:Il12a UTSW 3 68,602,520 (GRCm39) splice site probably null
R0646:Il12a UTSW 3 68,605,223 (GRCm39) splice site probably benign
R1083:Il12a UTSW 3 68,602,666 (GRCm39) missense probably damaging 1.00
R1588:Il12a UTSW 3 68,602,896 (GRCm39) missense probably benign 0.04
R2240:Il12a UTSW 3 68,601,517 (GRCm39) nonsense probably null
R2909:Il12a UTSW 3 68,605,320 (GRCm39) frame shift probably null
R2925:Il12a UTSW 3 68,605,320 (GRCm39) frame shift probably null
R3696:Il12a UTSW 3 68,605,320 (GRCm39) frame shift probably null
R3697:Il12a UTSW 3 68,605,320 (GRCm39) frame shift probably null
R3698:Il12a UTSW 3 68,605,320 (GRCm39) frame shift probably null
R4332:Il12a UTSW 3 68,602,594 (GRCm39) intron probably benign
R5809:Il12a UTSW 3 68,602,595 (GRCm39) intron probably benign
R6279:Il12a UTSW 3 68,605,312 (GRCm39) missense probably damaging 0.96
R6305:Il12a UTSW 3 68,601,511 (GRCm39) missense possibly damaging 0.80
R6847:Il12a UTSW 3 68,602,899 (GRCm39) missense probably damaging 1.00
R7751:Il12a UTSW 3 68,605,235 (GRCm39) missense probably damaging 1.00
R8188:Il12a UTSW 3 68,598,872 (GRCm39) missense unknown
R8339:Il12a UTSW 3 68,599,438 (GRCm39) nonsense probably null
R9145:Il12a UTSW 3 68,598,875 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CCCAAAAGCAGTTATGATGGTG -3'
(R):5'- ATGGGCTGGAACTACAGGAC -3'

Sequencing Primer
(F):5'- TCTCAGCACTTGATAGGCAG -3'
(R):5'- CCCTGCTGCATTTCAGAAAAGTG -3'
Posted On 2019-12-04