Incidental Mutation 'RF003:Zfp384'
ID 602620
Institutional Source Beutler Lab
Gene Symbol Zfp384
Ensembl Gene ENSMUSG00000038346
Gene Name zinc finger protein 384
Synonyms Ciz, C130073D16Rik, Nmp4
Accession Numbers
Essential gene? Probably non essential (E-score: 0.141) question?
Stock # RF003 (G1)
Quality Score 217.468
Status Not validated
Chromosome 6
Chromosomal Location 124986108-125014833 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) GCCCAGGCCCAGGCCCAGGCCCAG to GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG at 125013434 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032480] [ENSMUST00000046064] [ENSMUST00000054553] [ENSMUST00000084275] [ENSMUST00000088308] [ENSMUST00000112417] [ENSMUST00000112424] [ENSMUST00000112425] [ENSMUST00000112427] [ENSMUST00000112428] [ENSMUST00000140131]
AlphaFold E9Q1A5
Predicted Effect probably benign
Transcript: ENSMUST00000032480
SMART Domains Protein: ENSMUSP00000032480
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 5 107 5.5e-35 PFAM
low complexity region 118 131 N/A INTRINSIC
PHD 197 242 3.67e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000046064
SMART Domains Protein: ENSMUSP00000037986
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 260 282 3.47e0 SMART
ZnF_C2H2 288 310 2.99e-4 SMART
ZnF_C2H2 316 338 1.95e-3 SMART
ZnF_C2H2 344 368 7.37e-4 SMART
ZnF_C2H2 374 396 5.06e-2 SMART
ZnF_C2H2 404 426 3.44e-4 SMART
low complexity region 432 490 N/A INTRINSIC
low complexity region 491 496 N/A INTRINSIC
low complexity region 499 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054553
SMART Domains Protein: ENSMUSP00000086354
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 133 144 N/A INTRINSIC
ZnF_C2H2 174 196 7.26e-3 SMART
ZnF_C2H2 202 224 2.99e-4 SMART
ZnF_C2H2 230 252 1.95e-3 SMART
ZnF_C2H2 258 282 7.37e-4 SMART
ZnF_C2H2 288 310 5.06e-2 SMART
ZnF_C2H2 318 340 3.44e-4 SMART
low complexity region 346 404 N/A INTRINSIC
low complexity region 405 410 N/A INTRINSIC
low complexity region 413 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084275
SMART Domains Protein: ENSMUSP00000081296
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 318 340 7.37e-4 SMART
ZnF_C2H2 346 368 2.95e-3 SMART
ZnF_C2H2 374 398 7.37e-4 SMART
ZnF_C2H2 404 426 5.06e-2 SMART
ZnF_C2H2 434 456 3.44e-4 SMART
low complexity region 462 520 N/A INTRINSIC
low complexity region 521 526 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088308
SMART Domains Protein: ENSMUSP00000085648
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 318 340 7.37e-4 SMART
ZnF_C2H2 346 368 2.95e-3 SMART
ZnF_C2H2 374 398 7.37e-4 SMART
ZnF_C2H2 404 426 5.06e-2 SMART
ZnF_C2H2 434 456 3.44e-4 SMART
low complexity region 462 520 N/A INTRINSIC
low complexity region 521 526 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112417
SMART Domains Protein: ENSMUSP00000108036
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 5 107 6.5e-35 PFAM
low complexity region 118 126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112424
SMART Domains Protein: ENSMUSP00000108043
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 172 183 N/A INTRINSIC
ZnF_C2H2 213 235 7.26e-3 SMART
ZnF_C2H2 241 263 2.99e-4 SMART
ZnF_C2H2 269 291 1.95e-3 SMART
ZnF_C2H2 302 324 7.37e-4 SMART
ZnF_C2H2 330 352 2.95e-3 SMART
ZnF_C2H2 358 382 7.37e-4 SMART
ZnF_C2H2 388 410 5.06e-2 SMART
ZnF_C2H2 418 440 3.44e-4 SMART
low complexity region 446 504 N/A INTRINSIC
low complexity region 505 510 N/A INTRINSIC
low complexity region 513 533 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112425
SMART Domains Protein: ENSMUSP00000108044
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 313 337 7.37e-4 SMART
ZnF_C2H2 343 365 5.06e-2 SMART
ZnF_C2H2 373 395 3.44e-4 SMART
low complexity region 401 459 N/A INTRINSIC
low complexity region 460 465 N/A INTRINSIC
low complexity region 468 488 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112427
SMART Domains Protein: ENSMUSP00000108046
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 229 251 7.26e-3 SMART
ZnF_C2H2 257 279 2.99e-4 SMART
ZnF_C2H2 285 307 1.95e-3 SMART
ZnF_C2H2 318 340 7.37e-4 SMART
ZnF_C2H2 346 368 2.95e-3 SMART
ZnF_C2H2 374 398 7.37e-4 SMART
ZnF_C2H2 404 426 5.06e-2 SMART
ZnF_C2H2 434 456 3.44e-4 SMART
low complexity region 462 520 N/A INTRINSIC
low complexity region 521 526 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112428
SMART Domains Protein: ENSMUSP00000108047
Gene: ENSMUSG00000038346

DomainStartEndE-ValueType
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 260 282 3.47e0 SMART
ZnF_C2H2 288 310 2.99e-4 SMART
ZnF_C2H2 316 338 1.95e-3 SMART
ZnF_C2H2 344 368 7.37e-4 SMART
ZnF_C2H2 374 396 5.06e-2 SMART
ZnF_C2H2 404 426 3.44e-4 SMART
low complexity region 432 490 N/A INTRINSIC
low complexity region 491 496 N/A INTRINSIC
low complexity region 499 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140131
SMART Domains Protein: ENSMUSP00000121519
Gene: ENSMUSG00000030330

DomainStartEndE-ValueType
Pfam:ING 6 107 2.1e-35 PFAM
low complexity region 114 139 N/A INTRINSIC
PHD 198 243 3.67e-12 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2-type zinc finger protein, which may function as a transcription factor. This gene also contains long CAG trinucleotide repeats that encode consecutive glutamine residues. The protein appears to bind and regulate the promoters of the extracellular matrix genes MMP1, MMP3, MMP7 and COL1A1. Studies in mouse suggest that nuclear matrix transcription factors (NP/NMP4) may be part of a general mechanical pathway that couples cell construction and function during extracellular matrix remodeling. Alternative splicing results in multiple transcript variants. Recurrent rearrangements of this gene with the Ewing's sarcoma gene, EWSR1 on chromosome 22, or with the TAF15 gene on chromosome 17, or with the TCF3 (E2A) gene on chromosome 19, have been observed in acute leukemia. A related pseudogene has been identified on chromosome 7. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mice are small and males have a small testis. Some males develop infertility and exhibit variable degrees of spermatogenic cell degeneration within the seminiferous tubules and increased apoptosis of spermatogenic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik AACC A 7: 40,642,479 (GRCm39) probably benign Het
A630073D07Rik A C 6: 132,604,406 (GRCm39) L13R unknown Het
Alg9 GGC GGCCGC 9: 50,686,727 (GRCm39) probably benign Het
Arb2a A T 13: 77,982,794 (GRCm39) I135L possibly damaging Het
Arc G C 15: 74,543,980 (GRCm39) T81S probably benign Het
Atad5 A T 11: 80,002,386 (GRCm39) K1059N probably damaging Het
Bdp1 C A 13: 100,196,957 (GRCm39) V1143F probably benign Het
Bdp1 C A 13: 100,196,958 (GRCm39) Q1142H probably benign Het
Ccdc33 T C 9: 57,965,574 (GRCm39) S583G probably benign Het
Cd109 TTAT TTATTTATTTATATAT 9: 78,619,813 (GRCm39) probably benign Het
Cep192 A T 18: 67,971,027 (GRCm39) R1009S probably benign Het
Clvs2 T A 10: 33,498,921 (GRCm39) H3L probably damaging Het
Cnot6 T C 11: 49,593,440 (GRCm39) M14V probably benign Het
Colec10 A G 15: 54,325,787 (GRCm39) R206G possibly damaging Het
Dennd6a T C 14: 26,350,689 (GRCm39) I598T probably damaging Het
Dmrt2 T C 19: 25,655,498 (GRCm39) S366P probably damaging Het
Dnmt1 AGTTCCTACCTCGTT AGTTCCTACCTCGTTTTGGGGGCGGAGCACCGTTCCTACCTCGTT 9: 20,821,427 (GRCm39) probably null Het
Efhb T C 17: 53,707,919 (GRCm39) D748G probably damaging Het
Etl4 C T 2: 20,524,729 (GRCm39) Q21* probably null Het
Flywch1 CCACTCCTGGTGT CCACTCCTGGTGTGGGGAGGCTACGTACTCACACACTCCTGGTGT 17: 23,981,140 (GRCm39) probably null Het
Fmn1 ACCTCC ACCTCCCCCTCC 2: 113,356,131 (GRCm39) probably benign Het
Fsip2 T A 2: 82,821,865 (GRCm39) M5866K probably benign Het
Gab3 CTT CTTATT X: 74,043,612 (GRCm39) probably null Het
Garin5a C CGGAGGGAGGAAGGCTGGATCCTGGATACCTGGGTA 7: 44,149,951 (GRCm39) probably null Het
Gnl2 T A 4: 124,937,518 (GRCm39) probably null Het
Grip2 C T 6: 91,760,574 (GRCm39) R341Q probably benign Het
Hmcn1 T A 1: 150,500,312 (GRCm39) H3960L probably damaging Het
Igkv6-25 T A 6: 70,192,762 (GRCm39) Y56* probably null Het
Il12a A T 3: 68,602,562 (GRCm39) T102S probably benign Het
Il1a T A 2: 129,144,852 (GRCm39) I189F possibly damaging Het
Inpp4b T A 8: 82,696,150 (GRCm39) Y361* probably null Het
Iqcf4 CTTTTCCTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCATTTTCCTTTTCCTTTT 9: 106,447,806 (GRCm39) probably benign Het
Irag2 AGCACATTG AGCACATTGTGCACATTG 6: 145,119,509 (GRCm39) probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Las1l AGTGG AGTGGTGG X: 94,984,422 (GRCm39) probably benign Het
Lrrc8d T C 5: 105,960,507 (GRCm39) Y306H probably damaging Het
Mamld1 AGC AGCCGC X: 70,162,426 (GRCm39) probably benign Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,136,777 (GRCm39) probably benign Het
Map1b G T 13: 99,567,258 (GRCm39) A1821E unknown Het
Maz A G 7: 126,624,669 (GRCm39) C284R probably damaging Het
Med23 A G 10: 24,779,683 (GRCm39) H920R probably damaging Het
Megf10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 18: 57,427,099 (GRCm39) probably benign Het
Mmp14 C T 14: 54,676,471 (GRCm39) R339* probably null Het
Mroh9 T G 1: 162,885,630 (GRCm39) K334T probably damaging Het
Nab1 A T 1: 52,518,441 (GRCm39) C320S probably damaging Het
Noto T C 6: 85,401,192 (GRCm39) S74P probably benign Het
Nudt4 T C 10: 95,385,236 (GRCm39) N152D possibly damaging Het
Nup155 T TTTTG 15: 8,148,660 (GRCm39) probably benign Het
Nusap1 AGCTGAGA AGCTGAGATACACGTTAGCAGTGAGGAGCAGGCTGAGA 2: 119,458,084 (GRCm39) probably benign Het
Or10al2 A C 17: 37,983,749 (GRCm39) K278N probably damaging Het
Or2d4 T A 7: 106,543,855 (GRCm39) M118L probably damaging Het
Or2t48 CA C 11: 58,419,983 (GRCm39) probably null Het
Or51f1e GTTAT GTTATTAT 7: 102,747,512 (GRCm39) Het
Or51f1e TTA TTAGTA 7: 102,747,513 (GRCm39) probably null Het
Or7g16 T C 9: 18,726,778 (GRCm39) T271A probably benign Het
Or9a7 T C 6: 40,521,296 (GRCm39) I206V probably benign Het
Plxnc1 T C 10: 94,630,306 (GRCm39) Y1531C probably damaging Het
Pnma8b TGA TGAAGA 7: 16,679,941 (GRCm39) probably benign Het
Rp1 A G 1: 4,414,917 (GRCm39) V2065A probably damaging Het
Sbp AAGATGCTGACAACA AAGATGCTGACAACAGAGATGCTGACAACA 17: 24,164,343 (GRCm39) probably benign Het
Sepsecs G A 5: 52,804,533 (GRCm39) T379M probably benign Het
Sfswap GGCC GGCCCACTCTGCC 5: 129,646,828 (GRCm39) probably benign Het
Six3 GCG GCGTCG 17: 85,928,798 (GRCm39) probably benign Het
Tfeb C T 17: 48,099,003 (GRCm39) T259I possibly damaging Het
Tgoln1 A AAACTCAG 6: 72,593,335 (GRCm39) probably null Het
Tmem94 G A 11: 115,686,958 (GRCm39) V1108M probably damaging Het
Usp35 T C 7: 96,971,303 (GRCm39) K297E possibly damaging Het
Vcpkmt T A 12: 69,629,598 (GRCm39) T55S possibly damaging Het
Zfp407 A T 18: 84,227,688 (GRCm39) S1974T probably benign Het
Zfp677 T C 17: 21,617,704 (GRCm39) S254P probably damaging Het
Other mutations in Zfp384
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Zfp384 APN 6 125,002,016 (GRCm39) missense probably benign 0.03
IGL01568:Zfp384 APN 6 125,001,095 (GRCm39) missense probably damaging 1.00
IGL01632:Zfp384 APN 6 125,001,724 (GRCm39) missense probably damaging 1.00
IGL03408:Zfp384 APN 6 125,012,676 (GRCm39) missense probably damaging 1.00
FR4304:Zfp384 UTSW 6 125,013,456 (GRCm39) unclassified probably benign
FR4340:Zfp384 UTSW 6 125,013,426 (GRCm39) unclassified probably benign
R0839:Zfp384 UTSW 6 125,013,631 (GRCm39) missense probably benign 0.01
R1370:Zfp384 UTSW 6 125,013,416 (GRCm39) missense probably benign 0.04
R1427:Zfp384 UTSW 6 125,001,847 (GRCm39) missense probably damaging 1.00
R2441:Zfp384 UTSW 6 125,013,612 (GRCm39) missense probably benign 0.01
R2986:Zfp384 UTSW 6 125,001,859 (GRCm39) missense possibly damaging 0.78
R4003:Zfp384 UTSW 6 125,010,200 (GRCm39) splice site probably benign
R4833:Zfp384 UTSW 6 125,007,811 (GRCm39) missense probably damaging 1.00
R4860:Zfp384 UTSW 6 125,007,893 (GRCm39) synonymous silent
R5084:Zfp384 UTSW 6 125,000,642 (GRCm39) splice site probably benign
R5137:Zfp384 UTSW 6 125,013,472 (GRCm39) unclassified probably benign
R5449:Zfp384 UTSW 6 125,001,101 (GRCm39) missense probably damaging 1.00
R5558:Zfp384 UTSW 6 125,013,472 (GRCm39) unclassified probably benign
R5720:Zfp384 UTSW 6 125,013,587 (GRCm39) missense probably benign 0.19
R5849:Zfp384 UTSW 6 125,001,062 (GRCm39) missense possibly damaging 0.91
R5961:Zfp384 UTSW 6 125,000,997 (GRCm39) missense probably damaging 1.00
R6165:Zfp384 UTSW 6 125,001,896 (GRCm39) splice site probably null
R6948:Zfp384 UTSW 6 125,001,873 (GRCm39) missense probably benign 0.08
R7106:Zfp384 UTSW 6 125,001,222 (GRCm39) missense probably benign 0.23
R7192:Zfp384 UTSW 6 125,010,275 (GRCm39) missense probably damaging 1.00
R7320:Zfp384 UTSW 6 125,001,793 (GRCm39) missense possibly damaging 0.92
R7730:Zfp384 UTSW 6 125,008,635 (GRCm39) missense probably benign 0.02
R7861:Zfp384 UTSW 6 125,013,288 (GRCm39) missense probably damaging 1.00
R8080:Zfp384 UTSW 6 125,013,521 (GRCm39) missense unknown
R9021:Zfp384 UTSW 6 125,013,336 (GRCm39) missense
R9568:Zfp384 UTSW 6 125,001,796 (GRCm39) missense possibly damaging 0.70
R9606:Zfp384 UTSW 6 125,007,802 (GRCm39) missense possibly damaging 0.85
RF002:Zfp384 UTSW 6 125,013,434 (GRCm39) unclassified probably benign
RF003:Zfp384 UTSW 6 125,013,446 (GRCm39) unclassified probably benign
RF003:Zfp384 UTSW 6 125,013,439 (GRCm39) unclassified probably benign
RF010:Zfp384 UTSW 6 125,013,451 (GRCm39) unclassified probably benign
RF010:Zfp384 UTSW 6 125,013,434 (GRCm39) unclassified probably benign
RF011:Zfp384 UTSW 6 125,013,439 (GRCm39) unclassified probably benign
RF014:Zfp384 UTSW 6 125,013,429 (GRCm39) unclassified probably benign
RF015:Zfp384 UTSW 6 125,013,444 (GRCm39) unclassified probably benign
RF018:Zfp384 UTSW 6 125,013,452 (GRCm39) unclassified probably benign
RF020:Zfp384 UTSW 6 125,013,451 (GRCm39) unclassified probably benign
RF020:Zfp384 UTSW 6 125,013,418 (GRCm39) unclassified probably benign
RF022:Zfp384 UTSW 6 125,013,434 (GRCm39) unclassified probably benign
RF024:Zfp384 UTSW 6 125,013,452 (GRCm39) unclassified probably benign
RF026:Zfp384 UTSW 6 125,013,455 (GRCm39) unclassified probably benign
RF027:Zfp384 UTSW 6 125,013,453 (GRCm39) unclassified probably benign
RF030:Zfp384 UTSW 6 125,013,446 (GRCm39) unclassified probably benign
RF056:Zfp384 UTSW 6 125,013,453 (GRCm39) unclassified probably benign
RF057:Zfp384 UTSW 6 125,013,459 (GRCm39) unclassified probably benign
RF062:Zfp384 UTSW 6 125,013,429 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCAGGTTGAGACTTGCAGGTTG -3'
(R):5'- ATGCTCTGCCGGCTTATAGG -3'

Sequencing Primer
(F):5'- GAGACTTGCAGGTTGTCTTTTTCCC -3'
(R):5'- CCGGCTTATAGGGGGTCAAGTC -3'
Posted On 2019-12-04