Incidental Mutation 'RF003:4930433I11Rik'
ID 602626
Institutional Source Beutler Lab
Gene Symbol 4930433I11Rik
Ensembl Gene ENSMUSG00000091692
Gene Name RIKEN cDNA 4930433I11 gene
Synonyms LOC243944
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # RF003 (G1)
Quality Score 167.468
Status Not validated
Chromosome 7
Chromosomal Location 40637033-40644257 bp(+) (GRCm39)
Type of Mutation small deletion (1 aa in frame mutation)
DNA Base Change (assembly) AACC to A at 40642479 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171664] [ENSMUST00000206529]
AlphaFold A0A0U1RPT6
Predicted Effect probably benign
Transcript: ENSMUST00000171664
SMART Domains Protein: ENSMUSP00000131120
Gene: ENSMUSG00000091692

DomainStartEndE-ValueType
Pfam:DUF4629 208 354 2.2e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206360
Predicted Effect probably benign
Transcript: ENSMUST00000206529
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik A C 6: 132,604,406 (GRCm39) L13R unknown Het
Alg9 GGC GGCCGC 9: 50,686,727 (GRCm39) probably benign Het
Arb2a A T 13: 77,982,794 (GRCm39) I135L possibly damaging Het
Arc G C 15: 74,543,980 (GRCm39) T81S probably benign Het
Atad5 A T 11: 80,002,386 (GRCm39) K1059N probably damaging Het
Bdp1 C A 13: 100,196,957 (GRCm39) V1143F probably benign Het
Bdp1 C A 13: 100,196,958 (GRCm39) Q1142H probably benign Het
Ccdc33 T C 9: 57,965,574 (GRCm39) S583G probably benign Het
Cd109 TTAT TTATTTATTTATATAT 9: 78,619,813 (GRCm39) probably benign Het
Cep192 A T 18: 67,971,027 (GRCm39) R1009S probably benign Het
Clvs2 T A 10: 33,498,921 (GRCm39) H3L probably damaging Het
Cnot6 T C 11: 49,593,440 (GRCm39) M14V probably benign Het
Colec10 A G 15: 54,325,787 (GRCm39) R206G possibly damaging Het
Dennd6a T C 14: 26,350,689 (GRCm39) I598T probably damaging Het
Dmrt2 T C 19: 25,655,498 (GRCm39) S366P probably damaging Het
Dnmt1 AGTTCCTACCTCGTT AGTTCCTACCTCGTTTTGGGGGCGGAGCACCGTTCCTACCTCGTT 9: 20,821,427 (GRCm39) probably null Het
Efhb T C 17: 53,707,919 (GRCm39) D748G probably damaging Het
Etl4 C T 2: 20,524,729 (GRCm39) Q21* probably null Het
Flywch1 CCACTCCTGGTGT CCACTCCTGGTGTGGGGAGGCTACGTACTCACACACTCCTGGTGT 17: 23,981,140 (GRCm39) probably null Het
Fmn1 ACCTCC ACCTCCCCCTCC 2: 113,356,131 (GRCm39) probably benign Het
Fsip2 T A 2: 82,821,865 (GRCm39) M5866K probably benign Het
Gab3 CTT CTTATT X: 74,043,612 (GRCm39) probably null Het
Garin5a C CGGAGGGAGGAAGGCTGGATCCTGGATACCTGGGTA 7: 44,149,951 (GRCm39) probably null Het
Gnl2 T A 4: 124,937,518 (GRCm39) probably null Het
Grip2 C T 6: 91,760,574 (GRCm39) R341Q probably benign Het
Hmcn1 T A 1: 150,500,312 (GRCm39) H3960L probably damaging Het
Igkv6-25 T A 6: 70,192,762 (GRCm39) Y56* probably null Het
Il12a A T 3: 68,602,562 (GRCm39) T102S probably benign Het
Il1a T A 2: 129,144,852 (GRCm39) I189F possibly damaging Het
Inpp4b T A 8: 82,696,150 (GRCm39) Y361* probably null Het
Iqcf4 CTTTTCCTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCATTTTCCTTTTCCTTTT 9: 106,447,806 (GRCm39) probably benign Het
Irag2 AGCACATTG AGCACATTGTGCACATTG 6: 145,119,509 (GRCm39) probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Las1l AGTGG AGTGGTGG X: 94,984,422 (GRCm39) probably benign Het
Lrrc8d T C 5: 105,960,507 (GRCm39) Y306H probably damaging Het
Mamld1 AGC AGCCGC X: 70,162,426 (GRCm39) probably benign Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,136,777 (GRCm39) probably benign Het
Map1b G T 13: 99,567,258 (GRCm39) A1821E unknown Het
Maz A G 7: 126,624,669 (GRCm39) C284R probably damaging Het
Med23 A G 10: 24,779,683 (GRCm39) H920R probably damaging Het
Megf10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 18: 57,427,099 (GRCm39) probably benign Het
Mmp14 C T 14: 54,676,471 (GRCm39) R339* probably null Het
Mroh9 T G 1: 162,885,630 (GRCm39) K334T probably damaging Het
Nab1 A T 1: 52,518,441 (GRCm39) C320S probably damaging Het
Noto T C 6: 85,401,192 (GRCm39) S74P probably benign Het
Nudt4 T C 10: 95,385,236 (GRCm39) N152D possibly damaging Het
Nup155 T TTTTG 15: 8,148,660 (GRCm39) probably benign Het
Nusap1 AGCTGAGA AGCTGAGATACACGTTAGCAGTGAGGAGCAGGCTGAGA 2: 119,458,084 (GRCm39) probably benign Het
Or10al2 A C 17: 37,983,749 (GRCm39) K278N probably damaging Het
Or2d4 T A 7: 106,543,855 (GRCm39) M118L probably damaging Het
Or2t48 CA C 11: 58,419,983 (GRCm39) probably null Het
Or51f1e GTTAT GTTATTAT 7: 102,747,512 (GRCm39) Het
Or51f1e TTA TTAGTA 7: 102,747,513 (GRCm39) probably null Het
Or7g16 T C 9: 18,726,778 (GRCm39) T271A probably benign Het
Or9a7 T C 6: 40,521,296 (GRCm39) I206V probably benign Het
Plxnc1 T C 10: 94,630,306 (GRCm39) Y1531C probably damaging Het
Pnma8b TGA TGAAGA 7: 16,679,941 (GRCm39) probably benign Het
Rp1 A G 1: 4,414,917 (GRCm39) V2065A probably damaging Het
Sbp AAGATGCTGACAACA AAGATGCTGACAACAGAGATGCTGACAACA 17: 24,164,343 (GRCm39) probably benign Het
Sepsecs G A 5: 52,804,533 (GRCm39) T379M probably benign Het
Sfswap GGCC GGCCCACTCTGCC 5: 129,646,828 (GRCm39) probably benign Het
Six3 GCG GCGTCG 17: 85,928,798 (GRCm39) probably benign Het
Tfeb C T 17: 48,099,003 (GRCm39) T259I possibly damaging Het
Tgoln1 A AAACTCAG 6: 72,593,335 (GRCm39) probably null Het
Tmem94 G A 11: 115,686,958 (GRCm39) V1108M probably damaging Het
Usp35 T C 7: 96,971,303 (GRCm39) K297E possibly damaging Het
Vcpkmt T A 12: 69,629,598 (GRCm39) T55S possibly damaging Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,013,446 (GRCm39) probably benign Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,013,434 (GRCm39) probably benign Het
Zfp384 GGCCC GGCCCTGGCCCAAGCCC 6: 125,013,439 (GRCm39) probably benign Het
Zfp407 A T 18: 84,227,688 (GRCm39) S1974T probably benign Het
Zfp677 T C 17: 21,617,704 (GRCm39) S254P probably damaging Het
Other mutations in 4930433I11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02380:4930433I11Rik APN 7 40,643,968 (GRCm39) missense possibly damaging 0.50
BB002:4930433I11Rik UTSW 7 40,643,506 (GRCm39) nonsense probably null
BB012:4930433I11Rik UTSW 7 40,643,506 (GRCm39) nonsense probably null
FR4304:4930433I11Rik UTSW 7 40,642,480 (GRCm39) small deletion probably benign
FR4340:4930433I11Rik UTSW 7 40,642,479 (GRCm39) small deletion probably benign
FR4342:4930433I11Rik UTSW 7 40,642,479 (GRCm39) small deletion probably benign
FR4548:4930433I11Rik UTSW 7 40,642,480 (GRCm39) small deletion probably benign
R0498:4930433I11Rik UTSW 7 40,642,718 (GRCm39) missense probably benign 0.11
R0610:4930433I11Rik UTSW 7 40,642,480 (GRCm39) missense probably benign 0.22
R0704:4930433I11Rik UTSW 7 40,643,381 (GRCm39) missense probably damaging 1.00
R0723:4930433I11Rik UTSW 7 40,642,480 (GRCm39) missense probably benign 0.22
R0826:4930433I11Rik UTSW 7 40,642,480 (GRCm39) missense probably benign 0.22
R0850:4930433I11Rik UTSW 7 40,642,480 (GRCm39) missense probably benign 0.22
R0862:4930433I11Rik UTSW 7 40,642,480 (GRCm39) missense probably benign 0.22
R0863:4930433I11Rik UTSW 7 40,642,480 (GRCm39) missense probably benign 0.22
R0960:4930433I11Rik UTSW 7 40,642,480 (GRCm39) missense probably benign 0.22
R0961:4930433I11Rik UTSW 7 40,642,480 (GRCm39) missense probably benign 0.22
R0964:4930433I11Rik UTSW 7 40,642,480 (GRCm39) missense probably benign 0.22
R1099:4930433I11Rik UTSW 7 40,642,480 (GRCm39) missense probably benign 0.22
R1101:4930433I11Rik UTSW 7 40,642,480 (GRCm39) missense probably benign 0.22
R1167:4930433I11Rik UTSW 7 40,643,003 (GRCm39) missense probably damaging 1.00
R1401:4930433I11Rik UTSW 7 40,642,480 (GRCm39) missense probably benign 0.22
R1429:4930433I11Rik UTSW 7 40,642,480 (GRCm39) missense probably benign 0.22
R1462:4930433I11Rik UTSW 7 40,642,370 (GRCm39) nonsense probably null
R1462:4930433I11Rik UTSW 7 40,642,370 (GRCm39) nonsense probably null
R1816:4930433I11Rik UTSW 7 40,644,222 (GRCm39) nonsense probably null
R1852:4930433I11Rik UTSW 7 40,643,037 (GRCm39) missense probably benign 0.29
R3814:4930433I11Rik UTSW 7 40,642,343 (GRCm39) missense probably damaging 0.99
R4124:4930433I11Rik UTSW 7 40,643,345 (GRCm39) missense probably damaging 1.00
R4823:4930433I11Rik UTSW 7 40,642,786 (GRCm39) missense probably benign 0.00
R5092:4930433I11Rik UTSW 7 40,637,091 (GRCm39) start gained probably benign
R5792:4930433I11Rik UTSW 7 40,642,945 (GRCm39) missense possibly damaging 0.76
R6160:4930433I11Rik UTSW 7 40,642,950 (GRCm39) missense possibly damaging 0.91
R6300:4930433I11Rik UTSW 7 40,642,885 (GRCm39) missense possibly damaging 0.91
R6349:4930433I11Rik UTSW 7 40,644,196 (GRCm39) missense possibly damaging 0.89
R6755:4930433I11Rik UTSW 7 40,643,734 (GRCm39) missense probably damaging 1.00
R6995:4930433I11Rik UTSW 7 40,644,149 (GRCm39) missense probably benign 0.00
R7156:4930433I11Rik UTSW 7 40,643,282 (GRCm39) missense possibly damaging 0.54
R7232:4930433I11Rik UTSW 7 40,642,603 (GRCm39) missense probably damaging 1.00
R7318:4930433I11Rik UTSW 7 40,643,111 (GRCm39) missense probably benign 0.04
R7395:4930433I11Rik UTSW 7 40,639,102 (GRCm39) missense probably damaging 0.97
R7925:4930433I11Rik UTSW 7 40,643,506 (GRCm39) nonsense probably null
R8726:4930433I11Rik UTSW 7 40,644,226 (GRCm39) missense probably benign 0.04
R9190:4930433I11Rik UTSW 7 40,642,880 (GRCm39) missense possibly damaging 0.85
R9488:4930433I11Rik UTSW 7 40,643,212 (GRCm39) missense probably benign 0.00
RF004:4930433I11Rik UTSW 7 40,642,479 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GCAGAAAATCTTATTTACCGTTTACTG -3'
(R):5'- TTTCCAGTGTCAATGCAGTGC -3'

Sequencing Primer
(F):5'- GACTTCTTCCTTGACTCTTTTGCAG -3'
(R):5'- AGGCTGCTGCAAGTCAG -3'
Posted On 2019-12-04