Incidental Mutation 'RF003:Fam71e1'
ID 602627
Institutional Source Beutler Lab
Gene Symbol Fam71e1
Ensembl Gene ENSMUSG00000051113
Gene Name family with sequence similarity 71, member E1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock # RF003 (G1)
Quality Score 217.468
Status Not validated
Chromosome 7
Chromosomal Location 44496581-44501486 bp(+) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) C to CGGAGGGAGGAAGGCTGGATCCTGGATACCTGGGTA at 44500527 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107927] [ENSMUST00000118515] [ENSMUST00000118808] [ENSMUST00000138328] [ENSMUST00000165208] [ENSMUST00000205359] [ENSMUST00000205422] [ENSMUST00000206398]
AlphaFold A1L3C1
Predicted Effect probably benign
Transcript: ENSMUST00000107927
SMART Domains Protein: ENSMUSP00000103560
Gene: ENSMUSG00000051113

low complexity region 70 85 N/A INTRINSIC
Pfam:DUF3699 91 160 5.6e-20 PFAM
coiled coil region 164 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118515
SMART Domains Protein: ENSMUSP00000113141
Gene: ENSMUSG00000008140

signal peptide 1 27 N/A INTRINSIC
low complexity region 150 167 N/A INTRINSIC
low complexity region 239 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118808
SMART Domains Protein: ENSMUSP00000113509
Gene: ENSMUSG00000008140

signal peptide 1 27 N/A INTRINSIC
low complexity region 150 167 N/A INTRINSIC
transmembrane domain 221 243 N/A INTRINSIC
low complexity region 246 255 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138328
SMART Domains Protein: ENSMUSP00000116293
Gene: ENSMUSG00000008140

signal peptide 1 27 N/A INTRINSIC
low complexity region 154 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165208
SMART Domains Protein: ENSMUSP00000130127
Gene: ENSMUSG00000038670

low complexity region 2 37 N/A INTRINSIC
IG 54 150 6.26e-5 SMART
PDB:2LHU|A 160 236 7e-9 PDB
low complexity region 237 252 N/A INTRINSIC
IG 258 337 5.21e-2 SMART
IG 347 430 1.2e-1 SMART
IG 440 526 2.72e-5 SMART
IG 546 631 1.68e-5 SMART
FN3 634 717 3.29e-11 SMART
FN3 732 815 1.23e-10 SMART
IG 842 925 6.07e-3 SMART
FN3 928 1010 2.08e-8 SMART
IGc2 1055 1122 6.91e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000205359
Predicted Effect probably benign
Transcript: ENSMUST00000205422
Predicted Effect probably benign
Transcript: ENSMUST00000206398
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik AACC A 7: 40,993,055 probably benign Het
A630073D07Rik A C 6: 132,627,443 L13R unknown Het
Alg9 GGC GGCCGC 9: 50,775,427 probably benign Het
Arc G C 15: 74,672,131 T81S probably benign Het
Atad5 A T 11: 80,111,560 K1059N probably damaging Het
Bdp1 C A 13: 100,060,449 V1143F probably benign Het
Bdp1 C A 13: 100,060,450 Q1142H probably benign Het
Ccdc33 T C 9: 58,058,291 S583G probably benign Het
Cd109 TTAT TTATTTATTTATATAT 9: 78,712,531 probably benign Het
Cep192 A T 18: 67,837,956 R1009S probably benign Het
Clvs2 T A 10: 33,622,925 H3L probably damaging Het
Cnot6 T C 11: 49,702,613 M14V probably benign Het
Colec10 A G 15: 54,462,391 R206G possibly damaging Het
Dennd6a T C 14: 26,629,534 I598T probably damaging Het
Dmrt2 T C 19: 25,678,134 S366P probably damaging Het
Efhb T C 17: 53,400,891 D748G probably damaging Het
Etl4 C T 2: 20,519,918 Q21* probably null Het
Fam172a A T 13: 77,834,675 I135L possibly damaging Het
Fmn1 ACCTCC ACCTCCCCCTCC 2: 113,525,786 probably benign Het
Fsip2 T A 2: 82,991,521 M5866K probably benign Het
Gab3 CTT CTTATT X: 75,000,006 probably null Het
Gnl2 T A 4: 125,043,725 probably null Het
Grip2 C T 6: 91,783,593 R341Q probably benign Het
Hmcn1 T A 1: 150,624,561 H3960L probably damaging Het
Igkv6-25 T A 6: 70,215,778 Y56* probably null Het
Il12a A T 3: 68,695,229 T102S probably benign Het
Il1a T A 2: 129,302,932 I189F possibly damaging Het
Inpp4b T A 8: 81,969,521 Y361* probably null Het
Las1l AGTGG AGTGGTGG X: 95,940,816 probably benign Het
Lrmp AGCACATTG AGCACATTGTGCACATTG 6: 145,173,783 probably benign Het
Lrrc8d T C 5: 105,812,641 Y306H probably damaging Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Map1b G T 13: 99,430,750 A1821E unknown Het
Maz A G 7: 127,025,497 C284R probably damaging Het
Med23 A G 10: 24,903,785 H920R probably damaging Het
Mmp14 C T 14: 54,439,014 R339* probably null Het
Mroh9 T G 1: 163,058,061 K334T probably damaging Het
Nab1 A T 1: 52,479,282 C320S probably damaging Het
Noto T C 6: 85,424,210 S74P probably benign Het
Nudt4 T C 10: 95,549,374 N152D possibly damaging Het
Nup155 T TTTTG 15: 8,119,176 probably benign Het
Olfr118 A C 17: 37,672,858 K278N probably damaging Het
Olfr330 CA C 11: 58,529,157 probably null Het
Olfr461 T C 6: 40,544,362 I206V probably benign Het
Olfr585 GTTAT GTTATTAT 7: 103,098,305 Het
Olfr585 TTA TTAGTA 7: 103,098,306 probably null Het
Olfr710 T A 7: 106,944,648 M118L probably damaging Het
Olfr828 T C 9: 18,815,482 T271A probably benign Het
Plxnc1 T C 10: 94,794,444 Y1531C probably damaging Het
Pnmal2 TGA TGAAGA 7: 16,946,016 probably benign Het
Rp1 A G 1: 4,344,694 V2065A probably damaging Het
Sepsecs G A 5: 52,647,191 T379M probably benign Het
Sfswap GGCC GGCCCACTCTGCC 5: 129,569,764 probably benign Het
Six3 GCG GCGTCG 17: 85,621,370 probably benign Het
Tfeb C T 17: 47,788,078 T259I possibly damaging Het
Tgoln1 A AAACTCAG 6: 72,616,352 probably null Het
Tmem94 G A 11: 115,796,132 V1108M probably damaging Het
Usp35 T C 7: 97,322,096 K297E possibly damaging Het
Vcpkmt T A 12: 69,582,824 T55S possibly damaging Het
Zfp384 GGCCC GGCCCTGGCCCAAGCCC 6: 125,036,476 probably benign Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,036,483 probably benign Het
Zfp407 A T 18: 84,209,563 S1974T probably benign Het
Zfp677 T C 17: 21,397,442 S254P probably damaging Het
Other mutations in Fam71e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1355:Fam71e1 UTSW 7 44496691 missense possibly damaging 0.82
R5308:Fam71e1 UTSW 7 44500182 missense probably damaging 1.00
R5568:Fam71e1 UTSW 7 44501004 missense probably damaging 0.99
R6038:Fam71e1 UTSW 7 44500295 missense probably damaging 1.00
R6038:Fam71e1 UTSW 7 44500295 missense probably damaging 1.00
R8136:Fam71e1 UTSW 7 44500280 missense probably damaging 0.99
R8994:Fam71e1 UTSW 7 44496918 missense probably benign 0.09
R9716:Fam71e1 UTSW 7 44500981 missense probably damaging 1.00
RF002:Fam71e1 UTSW 7 44500520 nonsense probably null
RF013:Fam71e1 UTSW 7 44500520 frame shift probably null
RF015:Fam71e1 UTSW 7 44500522 frame shift probably null
RF017:Fam71e1 UTSW 7 44500525 frame shift probably null
RF017:Fam71e1 UTSW 7 44500531 frame shift probably null
RF020:Fam71e1 UTSW 7 44500535 frame shift probably null
RF034:Fam71e1 UTSW 7 44500523 frame shift probably null
RF038:Fam71e1 UTSW 7 44500522 frame shift probably null
RF040:Fam71e1 UTSW 7 44500521 frame shift probably null
RF040:Fam71e1 UTSW 7 44500531 frame shift probably null
RF045:Fam71e1 UTSW 7 44500532 frame shift probably null
RF047:Fam71e1 UTSW 7 44500529 frame shift probably null
RF047:Fam71e1 UTSW 7 44500536 frame shift probably null
RF050:Fam71e1 UTSW 7 44500521 frame shift probably null
RF051:Fam71e1 UTSW 7 44500523 frame shift probably null
RF055:Fam71e1 UTSW 7 44500533 nonsense probably null
RF056:Fam71e1 UTSW 7 44500527 frame shift probably null
RF057:Fam71e1 UTSW 7 44500532 frame shift probably null
RF060:Fam71e1 UTSW 7 44500525 frame shift probably null
RF060:Fam71e1 UTSW 7 44500533 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04