Incidental Mutation 'RF003:Usp35'
ID 602628
Institutional Source Beutler Lab
Gene Symbol Usp35
Ensembl Gene ENSMUSG00000035713
Gene Name ubiquitin specific peptidase 35
Synonyms LOC381901, LOC244144
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # RF003 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 97309380-97332020 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 97322096 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 297 (K297E)
Ref Sequence ENSEMBL: ENSMUSP00000137726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000139582] [ENSMUST00000168435]
AlphaFold M0QWN7
Predicted Effect possibly damaging
Transcript: ENSMUST00000139582
AA Change: K297E

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137726
Gene: ENSMUSG00000035713
AA Change: K297E

DomainStartEndE-ValueType
low complexity region 86 102 N/A INTRINSIC
Pfam:UCH 440 915 5.2e-50 PFAM
Pfam:UCH_1 441 890 1.5e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168435
AA Change: K297E

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137927
Gene: ENSMUSG00000035713
AA Change: K297E

DomainStartEndE-ValueType
low complexity region 86 102 N/A INTRINSIC
Pfam:UCH 440 915 7.1e-48 PFAM
Pfam:UCH_1 441 890 7.4e-26 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik AACC A 7: 40,993,055 probably benign Het
A630073D07Rik A C 6: 132,627,443 L13R unknown Het
Alg9 GGC GGCCGC 9: 50,775,427 probably benign Het
Arc G C 15: 74,672,131 T81S probably benign Het
Atad5 A T 11: 80,111,560 K1059N probably damaging Het
Bdp1 C A 13: 100,060,449 V1143F probably benign Het
Bdp1 C A 13: 100,060,450 Q1142H probably benign Het
Ccdc33 T C 9: 58,058,291 S583G probably benign Het
Cd109 TTAT TTATTTATTTATATAT 9: 78,712,531 probably benign Het
Cep192 A T 18: 67,837,956 R1009S probably benign Het
Clvs2 T A 10: 33,622,925 H3L probably damaging Het
Cnot6 T C 11: 49,702,613 M14V probably benign Het
Colec10 A G 15: 54,462,391 R206G possibly damaging Het
Dennd6a T C 14: 26,629,534 I598T probably damaging Het
Dmrt2 T C 19: 25,678,134 S366P probably damaging Het
Dnmt1 AGTTCCTACCTCGTT AGTTCCTACCTCGTTTTGGGGGCGGAGCACCGTTCCTACCTCGTT 9: 20,910,131 probably null Het
Efhb T C 17: 53,400,891 D748G probably damaging Het
Etl4 C T 2: 20,519,918 Q21* probably null Het
Fam172a A T 13: 77,834,675 I135L possibly damaging Het
Fam71e1 C CGGAGGGAGGAAGGCTGGATCCTGGATACCTGGGTA 7: 44,500,527 probably null Het
Flywch1 CCACTCCTGGTGT CCACTCCTGGTGTGGGGAGGCTACGTACTCACACACTCCTGGTGT 17: 23,762,166 probably null Het
Fmn1 ACCTCC ACCTCCCCCTCC 2: 113,525,786 probably benign Het
Fsip2 T A 2: 82,991,521 M5866K probably benign Het
Gab3 CTT CTTATT X: 75,000,006 probably null Het
Gnl2 T A 4: 125,043,725 probably null Het
Grip2 C T 6: 91,783,593 R341Q probably benign Het
Hmcn1 T A 1: 150,624,561 H3960L probably damaging Het
Igkv6-25 T A 6: 70,215,778 Y56* probably null Het
Il12a A T 3: 68,695,229 T102S probably benign Het
Il1a T A 2: 129,302,932 I189F possibly damaging Het
Inpp4b T A 8: 81,969,521 Y361* probably null Het
Iqcf4 CTTTTCCTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCATTTTCCTTTTCCTTTT 9: 106,570,607 probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Las1l AGTGG AGTGGTGG X: 95,940,816 probably benign Het
Lrmp AGCACATTG AGCACATTGTGCACATTG 6: 145,173,783 probably benign Het
Lrrc8d T C 5: 105,812,641 Y306H probably damaging Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,306,296 probably benign Het
Map1b G T 13: 99,430,750 A1821E unknown Het
Maz A G 7: 127,025,497 C284R probably damaging Het
Med23 A G 10: 24,903,785 H920R probably damaging Het
Megf10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 18: 57,294,027 probably benign Het
Mmp14 C T 14: 54,439,014 R339* probably null Het
Mroh9 T G 1: 163,058,061 K334T probably damaging Het
Nab1 A T 1: 52,479,282 C320S probably damaging Het
Noto T C 6: 85,424,210 S74P probably benign Het
Nudt4 T C 10: 95,549,374 N152D possibly damaging Het
Nup155 T TTTTG 15: 8,119,176 probably benign Het
Nusap1 AGCTGAGA AGCTGAGATACACGTTAGCAGTGAGGAGCAGGCTGAGA 2: 119,627,603 probably benign Het
Olfr118 A C 17: 37,672,858 K278N probably damaging Het
Olfr330 CA C 11: 58,529,157 probably null Het
Olfr461 T C 6: 40,544,362 I206V probably benign Het
Olfr585 GTTAT GTTATTAT 7: 103,098,305 Het
Olfr585 TTA TTAGTA 7: 103,098,306 probably null Het
Olfr710 T A 7: 106,944,648 M118L probably damaging Het
Olfr828 T C 9: 18,815,482 T271A probably benign Het
Plxnc1 T C 10: 94,794,444 Y1531C probably damaging Het
Pnmal2 TGA TGAAGA 7: 16,946,016 probably benign Het
Rp1 A G 1: 4,344,694 V2065A probably damaging Het
Sbp AAGATGCTGACAACA AAGATGCTGACAACAGAGATGCTGACAACA 17: 23,945,369 probably benign Het
Sepsecs G A 5: 52,647,191 T379M probably benign Het
Sfswap GGCC GGCCCACTCTGCC 5: 129,569,764 probably benign Het
Six3 GCG GCGTCG 17: 85,621,370 probably benign Het
Tfeb C T 17: 47,788,078 T259I possibly damaging Het
Tgoln1 A AAACTCAG 6: 72,616,352 probably null Het
Tmem94 G A 11: 115,796,132 V1108M probably damaging Het
Vcpkmt T A 12: 69,582,824 T55S possibly damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp384 GGCCC GGCCCTGGCCCAAGCCC 6: 125,036,476 probably benign Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,036,483 probably benign Het
Zfp407 A T 18: 84,209,563 S1974T probably benign Het
Zfp677 T C 17: 21,397,442 S254P probably damaging Het
Other mutations in Usp35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03239:Usp35 APN 7 97321592 missense possibly damaging 0.62
R0046:Usp35 UTSW 7 97313597 splice site probably null
R0046:Usp35 UTSW 7 97313597 splice site probably null
R0739:Usp35 UTSW 7 97311667 nonsense probably null
R2655:Usp35 UTSW 7 97312147 missense probably benign
R3623:Usp35 UTSW 7 97312620 missense probably damaging 1.00
R4750:Usp35 UTSW 7 97310339 missense possibly damaging 0.85
R4967:Usp35 UTSW 7 97313575 missense probably damaging 1.00
R5317:Usp35 UTSW 7 97311639 missense probably damaging 0.99
R5341:Usp35 UTSW 7 97325927 missense probably damaging 1.00
R5761:Usp35 UTSW 7 97312351 missense probably benign 0.00
R5894:Usp35 UTSW 7 97313077 missense probably damaging 1.00
R6113:Usp35 UTSW 7 97324326 missense probably damaging 1.00
R6282:Usp35 UTSW 7 97325948 missense probably damaging 1.00
R6454:Usp35 UTSW 7 97311560 missense probably damaging 0.98
R6454:Usp35 UTSW 7 97311644 nonsense probably null
R7142:Usp35 UTSW 7 97311547 missense probably damaging 0.97
R7158:Usp35 UTSW 7 97325964 start codon destroyed probably null 0.89
R7260:Usp35 UTSW 7 97320079 missense probably damaging 0.98
R8270:Usp35 UTSW 7 97312344 missense probably benign
R8275:Usp35 UTSW 7 97314819 missense probably damaging 1.00
R8795:Usp35 UTSW 7 97311960 missense possibly damaging 0.92
R8795:Usp35 UTSW 7 97312063 missense probably benign
R9198:Usp35 UTSW 7 97313069 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACACAGTGGAATGAGTGGTC -3'
(R):5'- TCAGGACTTTACGGCCAGTC -3'

Sequencing Primer
(F):5'- AGGGGCAGTGATATAACCCTGTC -3'
(R):5'- GACTTTACGGCCAGTCCCTAG -3'
Posted On 2019-12-04