Incidental Mutation 'RF003:Or51f1e'
ID 602630
Institutional Source Beutler Lab
Gene Symbol Or51f1e
Ensembl Gene ENSMUSG00000078080
Gene Name olfactory receptor family 51 subfamily F member 1E
Synonyms Olfr585, GA_x6K02T2PBJ9-5809085-5810035, MOR14-4
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # RF003 (G1)
Quality Score 214.458
Status Not validated
Chromosome 7
Chromosomal Location 102746950-102747906 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) TTA to TTAGTA at 102747513 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000100476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104881]
AlphaFold E9PXW4
Predicted Effect probably null
Transcript: ENSMUST00000104881
SMART Domains Protein: ENSMUSP00000100476
Gene: ENSMUSG00000078080

DomainStartEndE-ValueType
Pfam:7tm_4 40 318 1.3e-109 PFAM
Pfam:7TM_GPCR_Srsx 45 315 5.9e-6 PFAM
Pfam:7tm_1 50 300 7.9e-23 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik AACC A 7: 40,642,479 (GRCm39) probably benign Het
A630073D07Rik A C 6: 132,604,406 (GRCm39) L13R unknown Het
Alg9 GGC GGCCGC 9: 50,686,727 (GRCm39) probably benign Het
Arb2a A T 13: 77,982,794 (GRCm39) I135L possibly damaging Het
Arc G C 15: 74,543,980 (GRCm39) T81S probably benign Het
Atad5 A T 11: 80,002,386 (GRCm39) K1059N probably damaging Het
Bdp1 C A 13: 100,196,957 (GRCm39) V1143F probably benign Het
Bdp1 C A 13: 100,196,958 (GRCm39) Q1142H probably benign Het
Ccdc33 T C 9: 57,965,574 (GRCm39) S583G probably benign Het
Cd109 TTAT TTATTTATTTATATAT 9: 78,619,813 (GRCm39) probably benign Het
Cep192 A T 18: 67,971,027 (GRCm39) R1009S probably benign Het
Clvs2 T A 10: 33,498,921 (GRCm39) H3L probably damaging Het
Cnot6 T C 11: 49,593,440 (GRCm39) M14V probably benign Het
Colec10 A G 15: 54,325,787 (GRCm39) R206G possibly damaging Het
Dennd6a T C 14: 26,350,689 (GRCm39) I598T probably damaging Het
Dmrt2 T C 19: 25,655,498 (GRCm39) S366P probably damaging Het
Dnmt1 AGTTCCTACCTCGTT AGTTCCTACCTCGTTTTGGGGGCGGAGCACCGTTCCTACCTCGTT 9: 20,821,427 (GRCm39) probably null Het
Efhb T C 17: 53,707,919 (GRCm39) D748G probably damaging Het
Etl4 C T 2: 20,524,729 (GRCm39) Q21* probably null Het
Flywch1 CCACTCCTGGTGT CCACTCCTGGTGTGGGGAGGCTACGTACTCACACACTCCTGGTGT 17: 23,981,140 (GRCm39) probably null Het
Fmn1 ACCTCC ACCTCCCCCTCC 2: 113,356,131 (GRCm39) probably benign Het
Fsip2 T A 2: 82,821,865 (GRCm39) M5866K probably benign Het
Gab3 CTT CTTATT X: 74,043,612 (GRCm39) probably null Het
Garin5a C CGGAGGGAGGAAGGCTGGATCCTGGATACCTGGGTA 7: 44,149,951 (GRCm39) probably null Het
Gnl2 T A 4: 124,937,518 (GRCm39) probably null Het
Grip2 C T 6: 91,760,574 (GRCm39) R341Q probably benign Het
Hmcn1 T A 1: 150,500,312 (GRCm39) H3960L probably damaging Het
Igkv6-25 T A 6: 70,192,762 (GRCm39) Y56* probably null Het
Il12a A T 3: 68,602,562 (GRCm39) T102S probably benign Het
Il1a T A 2: 129,144,852 (GRCm39) I189F possibly damaging Het
Inpp4b T A 8: 82,696,150 (GRCm39) Y361* probably null Het
Iqcf4 CTTTTCCTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCATTTTCCTTTTCCTTTT 9: 106,447,806 (GRCm39) probably benign Het
Irag2 AGCACATTG AGCACATTGTGCACATTG 6: 145,119,509 (GRCm39) probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Las1l AGTGG AGTGGTGG X: 94,984,422 (GRCm39) probably benign Het
Lrrc8d T C 5: 105,960,507 (GRCm39) Y306H probably damaging Het
Mamld1 AGC AGCCGC X: 70,162,426 (GRCm39) probably benign Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,136,777 (GRCm39) probably benign Het
Map1b G T 13: 99,567,258 (GRCm39) A1821E unknown Het
Maz A G 7: 126,624,669 (GRCm39) C284R probably damaging Het
Med23 A G 10: 24,779,683 (GRCm39) H920R probably damaging Het
Megf10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 18: 57,427,099 (GRCm39) probably benign Het
Mmp14 C T 14: 54,676,471 (GRCm39) R339* probably null Het
Mroh9 T G 1: 162,885,630 (GRCm39) K334T probably damaging Het
Nab1 A T 1: 52,518,441 (GRCm39) C320S probably damaging Het
Noto T C 6: 85,401,192 (GRCm39) S74P probably benign Het
Nudt4 T C 10: 95,385,236 (GRCm39) N152D possibly damaging Het
Nup155 T TTTTG 15: 8,148,660 (GRCm39) probably benign Het
Nusap1 AGCTGAGA AGCTGAGATACACGTTAGCAGTGAGGAGCAGGCTGAGA 2: 119,458,084 (GRCm39) probably benign Het
Or10al2 A C 17: 37,983,749 (GRCm39) K278N probably damaging Het
Or2d4 T A 7: 106,543,855 (GRCm39) M118L probably damaging Het
Or2t48 CA C 11: 58,419,983 (GRCm39) probably null Het
Or7g16 T C 9: 18,726,778 (GRCm39) T271A probably benign Het
Or9a7 T C 6: 40,521,296 (GRCm39) I206V probably benign Het
Plxnc1 T C 10: 94,630,306 (GRCm39) Y1531C probably damaging Het
Pnma8b TGA TGAAGA 7: 16,679,941 (GRCm39) probably benign Het
Rp1 A G 1: 4,414,917 (GRCm39) V2065A probably damaging Het
Sbp AAGATGCTGACAACA AAGATGCTGACAACAGAGATGCTGACAACA 17: 24,164,343 (GRCm39) probably benign Het
Sepsecs G A 5: 52,804,533 (GRCm39) T379M probably benign Het
Sfswap GGCC GGCCCACTCTGCC 5: 129,646,828 (GRCm39) probably benign Het
Six3 GCG GCGTCG 17: 85,928,798 (GRCm39) probably benign Het
Tfeb C T 17: 48,099,003 (GRCm39) T259I possibly damaging Het
Tgoln1 A AAACTCAG 6: 72,593,335 (GRCm39) probably null Het
Tmem94 G A 11: 115,686,958 (GRCm39) V1108M probably damaging Het
Usp35 T C 7: 96,971,303 (GRCm39) K297E possibly damaging Het
Vcpkmt T A 12: 69,629,598 (GRCm39) T55S possibly damaging Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,013,446 (GRCm39) probably benign Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,013,434 (GRCm39) probably benign Het
Zfp384 GGCCC GGCCCTGGCCCAAGCCC 6: 125,013,439 (GRCm39) probably benign Het
Zfp407 A T 18: 84,227,688 (GRCm39) S1974T probably benign Het
Zfp677 T C 17: 21,617,704 (GRCm39) S254P probably damaging Het
Other mutations in Or51f1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Or51f1e APN 7 102,747,077 (GRCm39) missense probably damaging 1.00
IGL02866:Or51f1e APN 7 102,747,590 (GRCm39) missense probably damaging 0.99
FR4548:Or51f1e UTSW 7 102,747,516 (GRCm39) nonsense probably null
FR4976:Or51f1e UTSW 7 102,747,516 (GRCm39) small insertion probably benign
R0893:Or51f1e UTSW 7 102,747,641 (GRCm39) missense probably benign 0.01
R0926:Or51f1e UTSW 7 102,747,092 (GRCm39) missense probably damaging 1.00
R1486:Or51f1e UTSW 7 102,747,637 (GRCm39) missense probably damaging 1.00
R2031:Or51f1e UTSW 7 102,747,371 (GRCm39) missense probably damaging 0.98
R3852:Or51f1e UTSW 7 102,747,391 (GRCm39) missense probably damaging 0.97
R4849:Or51f1e UTSW 7 102,747,526 (GRCm39) missense possibly damaging 0.95
R5241:Or51f1e UTSW 7 102,747,524 (GRCm39) missense probably benign 0.36
R5668:Or51f1e UTSW 7 102,747,103 (GRCm39) missense probably benign 0.42
R5841:Or51f1e UTSW 7 102,747,161 (GRCm39) missense probably damaging 1.00
R6902:Or51f1e UTSW 7 102,747,562 (GRCm39) missense probably benign 0.12
R7943:Or51f1e UTSW 7 102,747,153 (GRCm39) missense probably damaging 0.98
R8265:Or51f1e UTSW 7 102,747,304 (GRCm39) missense probably benign 0.00
R8969:Or51f1e UTSW 7 102,747,251 (GRCm39) missense probably damaging 0.99
R9345:Or51f1e UTSW 7 102,747,713 (GRCm39) missense possibly damaging 0.93
R9376:Or51f1e UTSW 7 102,746,971 (GRCm39) missense probably benign 0.01
R9702:Or51f1e UTSW 7 102,747,343 (GRCm39) missense probably damaging 0.99
RF003:Or51f1e UTSW 7 102,747,512 (GRCm39)
RF004:Or51f1e UTSW 7 102,747,516 (GRCm39) nonsense probably null
RF004:Or51f1e UTSW 7 102,747,515 (GRCm39) small insertion probably benign
RF004:Or51f1e UTSW 7 102,747,512 (GRCm39)
Predicted Primers PCR Primer
(F):5'- GGTTCACATGTACAGAATCTGGAG -3'
(R):5'- AAGTGCTGAAGGCCTTGTGTC -3'

Sequencing Primer
(F):5'- CACATGTACAGAATCTGGAGTGTTAG -3'
(R):5'- CGTTCTTCAGATGAGGCAATATTGAG -3'
Posted On 2019-12-04