Incidental Mutation 'RF003:Olfr710'
ID 602631
Institutional Source Beutler Lab
Gene Symbol Olfr710
Ensembl Gene ENSMUSG00000045581
Gene Name olfactory receptor 710
Synonyms GA_x6K02T2PBJ9-9325348-9324416, MOR260-3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock # RF003 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 106943911-106948312 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 106944648 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 118 (M118L)
Ref Sequence ENSEMBL: ENSMUSP00000062956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055923]
AlphaFold Q9EP55
Predicted Effect probably damaging
Transcript: ENSMUST00000055923
AA Change: M118L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062956
Gene: ENSMUSG00000045581
AA Change: M118L

Pfam:7tm_4 31 308 5.1e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.9e-9 PFAM
Pfam:7tm_1 41 290 1.2e-23 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik AACC A 7: 40,993,055 probably benign Het
A630073D07Rik A C 6: 132,627,443 L13R unknown Het
Alg9 GGC GGCCGC 9: 50,775,427 probably benign Het
Arc G C 15: 74,672,131 T81S probably benign Het
Atad5 A T 11: 80,111,560 K1059N probably damaging Het
Bdp1 C A 13: 100,060,449 V1143F probably benign Het
Bdp1 C A 13: 100,060,450 Q1142H probably benign Het
Ccdc33 T C 9: 58,058,291 S583G probably benign Het
Cd109 TTAT TTATTTATTTATATAT 9: 78,712,531 probably benign Het
Cep192 A T 18: 67,837,956 R1009S probably benign Het
Clvs2 T A 10: 33,622,925 H3L probably damaging Het
Cnot6 T C 11: 49,702,613 M14V probably benign Het
Colec10 A G 15: 54,462,391 R206G possibly damaging Het
Dennd6a T C 14: 26,629,534 I598T probably damaging Het
Dmrt2 T C 19: 25,678,134 S366P probably damaging Het
Efhb T C 17: 53,400,891 D748G probably damaging Het
Etl4 C T 2: 20,519,918 Q21* probably null Het
Fam172a A T 13: 77,834,675 I135L possibly damaging Het
Fam71e1 C CGGAGGGAGGAAGGCTGGATCCTGGATACCTGGGTA 7: 44,500,527 probably null Het
Fmn1 ACCTCC ACCTCCCCCTCC 2: 113,525,786 probably benign Het
Fsip2 T A 2: 82,991,521 M5866K probably benign Het
Gab3 CTT CTTATT X: 75,000,006 probably null Het
Gnl2 T A 4: 125,043,725 probably null Het
Grip2 C T 6: 91,783,593 R341Q probably benign Het
Hmcn1 T A 1: 150,624,561 H3960L probably damaging Het
Igkv6-25 T A 6: 70,215,778 Y56* probably null Het
Il12a A T 3: 68,695,229 T102S probably benign Het
Il1a T A 2: 129,302,932 I189F possibly damaging Het
Inpp4b T A 8: 81,969,521 Y361* probably null Het
Las1l AGTGG AGTGGTGG X: 95,940,816 probably benign Het
Lrmp AGCACATTG AGCACATTGTGCACATTG 6: 145,173,783 probably benign Het
Lrrc8d T C 5: 105,812,641 Y306H probably damaging Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Map1b G T 13: 99,430,750 A1821E unknown Het
Maz A G 7: 127,025,497 C284R probably damaging Het
Med23 A G 10: 24,903,785 H920R probably damaging Het
Mmp14 C T 14: 54,439,014 R339* probably null Het
Mroh9 T G 1: 163,058,061 K334T probably damaging Het
Nab1 A T 1: 52,479,282 C320S probably damaging Het
Noto T C 6: 85,424,210 S74P probably benign Het
Nudt4 T C 10: 95,549,374 N152D possibly damaging Het
Nup155 T TTTTG 15: 8,119,176 probably benign Het
Olfr118 A C 17: 37,672,858 K278N probably damaging Het
Olfr330 CA C 11: 58,529,157 probably null Het
Olfr461 T C 6: 40,544,362 I206V probably benign Het
Olfr585 GTTAT GTTATTAT 7: 103,098,305 Het
Olfr585 TTA TTAGTA 7: 103,098,306 probably null Het
Olfr828 T C 9: 18,815,482 T271A probably benign Het
Plxnc1 T C 10: 94,794,444 Y1531C probably damaging Het
Pnmal2 TGA TGAAGA 7: 16,946,016 probably benign Het
Rp1 A G 1: 4,344,694 V2065A probably damaging Het
Sepsecs G A 5: 52,647,191 T379M probably benign Het
Sfswap GGCC GGCCCACTCTGCC 5: 129,569,764 probably benign Het
Six3 GCG GCGTCG 17: 85,621,370 probably benign Het
Tfeb C T 17: 47,788,078 T259I possibly damaging Het
Tgoln1 A AAACTCAG 6: 72,616,352 probably null Het
Tmem94 G A 11: 115,796,132 V1108M probably damaging Het
Usp35 T C 7: 97,322,096 K297E possibly damaging Het
Vcpkmt T A 12: 69,582,824 T55S possibly damaging Het
Zfp384 GGCCC GGCCCTGGCCCAAGCCC 6: 125,036,476 probably benign Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,036,483 probably benign Het
Zfp407 A T 18: 84,209,563 S1974T probably benign Het
Zfp677 T C 17: 21,397,442 S254P probably damaging Het
Other mutations in Olfr710
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Olfr710 APN 7 106944541 missense possibly damaging 0.77
IGL01534:Olfr710 APN 7 106944339 missense probably damaging 1.00
IGL02041:Olfr710 APN 7 106944113 missense possibly damaging 0.78
IGL02414:Olfr710 APN 7 106944758 missense probably benign 0.33
IGL02695:Olfr710 APN 7 106944663 missense possibly damaging 0.93
IGL03167:Olfr710 APN 7 106944645 missense probably damaging 0.99
IGL03242:Olfr710 APN 7 106944918 missense possibly damaging 0.59
R1985:Olfr710 UTSW 7 106944926 missense probably benign 0.00
R2234:Olfr710 UTSW 7 106944620 missense probably damaging 1.00
R3414:Olfr710 UTSW 7 106944176 nonsense probably null
R3731:Olfr710 UTSW 7 106944477 missense probably damaging 0.99
R3777:Olfr710 UTSW 7 106944312 missense probably benign 0.05
R4646:Olfr710 UTSW 7 106944340 missense probably benign 0.01
R4647:Olfr710 UTSW 7 106944340 missense probably benign 0.01
R4661:Olfr710 UTSW 7 106944867 missense probably damaging 0.98
R4679:Olfr710 UTSW 7 106944945 missense probably benign 0.10
R5200:Olfr710 UTSW 7 106944980 missense possibly damaging 0.77
R5495:Olfr710 UTSW 7 106944492 nonsense probably null
R6744:Olfr710 UTSW 7 106944534 missense probably damaging 1.00
R6908:Olfr710 UTSW 7 106944632 missense possibly damaging 0.82
R7463:Olfr710 UTSW 7 106944173 missense probably damaging 0.99
R7498:Olfr710 UTSW 7 106944368 missense possibly damaging 0.93
R8686:Olfr710 UTSW 7 106944698 missense probably benign 0.01
R9283:Olfr710 UTSW 7 106944599 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04