Incidental Mutation 'RF003:Cd109'
ID 602638
Institutional Source Beutler Lab
Gene Symbol Cd109
Ensembl Gene ENSMUSG00000046186
Gene Name CD109 antigen
Synonyms Gov platelet alloantigens, 9930012E15Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # RF003 (G1)
Quality Score 217.468
Status Not validated
Chromosome 9
Chromosomal Location 78522828-78623535 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) TTAT to TTATTTATTTATATAT at 78619813 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093812]
AlphaFold Q8R422
Predicted Effect probably benign
Transcript: ENSMUST00000093812
SMART Domains Protein: ENSMUSP00000091330
Gene: ENSMUSG00000046186

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:A2M_N 129 220 1.5e-16 PFAM
A2M_N_2 470 601 8.89e-32 SMART
A2M 695 786 2.07e-32 SMART
Pfam:Thiol-ester_cl 912 941 2.6e-20 PFAM
Pfam:A2M_comp 961 1197 1.9e-65 PFAM
low complexity region 1265 1275 N/A INTRINSIC
A2M_recep 1311 1395 2.06e-27 SMART
low complexity region 1422 1437 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl phosphatidylinositol (GPI)-linked glycoprotein that localizes to the surface of platelets, activated T-cells, and endothelial cells. The protein binds to and negatively regulates signalling by transforming growth factor beta (TGF-beta). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a null mutation display epidermal hyperplasia and thickening, sebaceous gland hyperplasia and transient impairment of hair growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik AACC A 7: 40,642,479 (GRCm39) probably benign Het
A630073D07Rik A C 6: 132,604,406 (GRCm39) L13R unknown Het
Alg9 GGC GGCCGC 9: 50,686,727 (GRCm39) probably benign Het
Arb2a A T 13: 77,982,794 (GRCm39) I135L possibly damaging Het
Arc G C 15: 74,543,980 (GRCm39) T81S probably benign Het
Atad5 A T 11: 80,002,386 (GRCm39) K1059N probably damaging Het
Bdp1 C A 13: 100,196,957 (GRCm39) V1143F probably benign Het
Bdp1 C A 13: 100,196,958 (GRCm39) Q1142H probably benign Het
Ccdc33 T C 9: 57,965,574 (GRCm39) S583G probably benign Het
Cep192 A T 18: 67,971,027 (GRCm39) R1009S probably benign Het
Clvs2 T A 10: 33,498,921 (GRCm39) H3L probably damaging Het
Cnot6 T C 11: 49,593,440 (GRCm39) M14V probably benign Het
Colec10 A G 15: 54,325,787 (GRCm39) R206G possibly damaging Het
Dennd6a T C 14: 26,350,689 (GRCm39) I598T probably damaging Het
Dmrt2 T C 19: 25,655,498 (GRCm39) S366P probably damaging Het
Dnmt1 AGTTCCTACCTCGTT AGTTCCTACCTCGTTTTGGGGGCGGAGCACCGTTCCTACCTCGTT 9: 20,821,427 (GRCm39) probably null Het
Efhb T C 17: 53,707,919 (GRCm39) D748G probably damaging Het
Etl4 C T 2: 20,524,729 (GRCm39) Q21* probably null Het
Flywch1 CCACTCCTGGTGT CCACTCCTGGTGTGGGGAGGCTACGTACTCACACACTCCTGGTGT 17: 23,981,140 (GRCm39) probably null Het
Fmn1 ACCTCC ACCTCCCCCTCC 2: 113,356,131 (GRCm39) probably benign Het
Fsip2 T A 2: 82,821,865 (GRCm39) M5866K probably benign Het
Gab3 CTT CTTATT X: 74,043,612 (GRCm39) probably null Het
Garin5a C CGGAGGGAGGAAGGCTGGATCCTGGATACCTGGGTA 7: 44,149,951 (GRCm39) probably null Het
Gnl2 T A 4: 124,937,518 (GRCm39) probably null Het
Grip2 C T 6: 91,760,574 (GRCm39) R341Q probably benign Het
Hmcn1 T A 1: 150,500,312 (GRCm39) H3960L probably damaging Het
Igkv6-25 T A 6: 70,192,762 (GRCm39) Y56* probably null Het
Il12a A T 3: 68,602,562 (GRCm39) T102S probably benign Het
Il1a T A 2: 129,144,852 (GRCm39) I189F possibly damaging Het
Inpp4b T A 8: 82,696,150 (GRCm39) Y361* probably null Het
Iqcf4 CTTTTCCTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCATTTTCCTTTTCCTTTT 9: 106,447,806 (GRCm39) probably benign Het
Irag2 AGCACATTG AGCACATTGTGCACATTG 6: 145,119,509 (GRCm39) probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Las1l AGTGG AGTGGTGG X: 94,984,422 (GRCm39) probably benign Het
Lrrc8d T C 5: 105,960,507 (GRCm39) Y306H probably damaging Het
Mamld1 AGC AGCCGC X: 70,162,426 (GRCm39) probably benign Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,136,777 (GRCm39) probably benign Het
Map1b G T 13: 99,567,258 (GRCm39) A1821E unknown Het
Maz A G 7: 126,624,669 (GRCm39) C284R probably damaging Het
Med23 A G 10: 24,779,683 (GRCm39) H920R probably damaging Het
Megf10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 18: 57,427,099 (GRCm39) probably benign Het
Mmp14 C T 14: 54,676,471 (GRCm39) R339* probably null Het
Mroh9 T G 1: 162,885,630 (GRCm39) K334T probably damaging Het
Nab1 A T 1: 52,518,441 (GRCm39) C320S probably damaging Het
Noto T C 6: 85,401,192 (GRCm39) S74P probably benign Het
Nudt4 T C 10: 95,385,236 (GRCm39) N152D possibly damaging Het
Nup155 T TTTTG 15: 8,148,660 (GRCm39) probably benign Het
Nusap1 AGCTGAGA AGCTGAGATACACGTTAGCAGTGAGGAGCAGGCTGAGA 2: 119,458,084 (GRCm39) probably benign Het
Or10al2 A C 17: 37,983,749 (GRCm39) K278N probably damaging Het
Or2d4 T A 7: 106,543,855 (GRCm39) M118L probably damaging Het
Or2t48 CA C 11: 58,419,983 (GRCm39) probably null Het
Or51f1e GTTAT GTTATTAT 7: 102,747,512 (GRCm39) Het
Or51f1e TTA TTAGTA 7: 102,747,513 (GRCm39) probably null Het
Or7g16 T C 9: 18,726,778 (GRCm39) T271A probably benign Het
Or9a7 T C 6: 40,521,296 (GRCm39) I206V probably benign Het
Plxnc1 T C 10: 94,630,306 (GRCm39) Y1531C probably damaging Het
Pnma8b TGA TGAAGA 7: 16,679,941 (GRCm39) probably benign Het
Rp1 A G 1: 4,414,917 (GRCm39) V2065A probably damaging Het
Sbp AAGATGCTGACAACA AAGATGCTGACAACAGAGATGCTGACAACA 17: 24,164,343 (GRCm39) probably benign Het
Sepsecs G A 5: 52,804,533 (GRCm39) T379M probably benign Het
Sfswap GGCC GGCCCACTCTGCC 5: 129,646,828 (GRCm39) probably benign Het
Six3 GCG GCGTCG 17: 85,928,798 (GRCm39) probably benign Het
Tfeb C T 17: 48,099,003 (GRCm39) T259I possibly damaging Het
Tgoln1 A AAACTCAG 6: 72,593,335 (GRCm39) probably null Het
Tmem94 G A 11: 115,686,958 (GRCm39) V1108M probably damaging Het
Usp35 T C 7: 96,971,303 (GRCm39) K297E possibly damaging Het
Vcpkmt T A 12: 69,629,598 (GRCm39) T55S possibly damaging Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,013,446 (GRCm39) probably benign Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,013,434 (GRCm39) probably benign Het
Zfp384 GGCCC GGCCCTGGCCCAAGCCC 6: 125,013,439 (GRCm39) probably benign Het
Zfp407 A T 18: 84,227,688 (GRCm39) S1974T probably benign Het
Zfp677 T C 17: 21,617,704 (GRCm39) S254P probably damaging Het
Other mutations in Cd109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cd109 APN 9 78,524,251 (GRCm39) missense probably damaging 1.00
IGL00465:Cd109 APN 9 78,568,216 (GRCm39) nonsense probably null
IGL00667:Cd109 APN 9 78,592,159 (GRCm39) missense probably damaging 0.99
IGL01432:Cd109 APN 9 78,605,405 (GRCm39) missense probably benign
IGL01795:Cd109 APN 9 78,569,047 (GRCm39) splice site probably benign
IGL02343:Cd109 APN 9 78,596,237 (GRCm39) splice site probably benign
IGL02450:Cd109 APN 9 78,603,132 (GRCm39) missense possibly damaging 0.83
IGL02699:Cd109 APN 9 78,579,271 (GRCm39) splice site probably benign
IGL02738:Cd109 APN 9 78,598,581 (GRCm39) missense probably damaging 1.00
IGL02797:Cd109 APN 9 78,568,995 (GRCm39) missense probably damaging 0.96
IGL03160:Cd109 APN 9 78,568,338 (GRCm39) splice site probably null
IGL03349:Cd109 APN 9 78,543,767 (GRCm39) missense probably benign 0.34
FR4589:Cd109 UTSW 9 78,619,811 (GRCm39) critical splice acceptor site probably benign
R0048:Cd109 UTSW 9 78,587,303 (GRCm39) missense possibly damaging 0.50
R0060:Cd109 UTSW 9 78,610,389 (GRCm39) missense probably damaging 1.00
R0060:Cd109 UTSW 9 78,610,389 (GRCm39) missense probably damaging 1.00
R0158:Cd109 UTSW 9 78,596,214 (GRCm39) missense possibly damaging 0.49
R0415:Cd109 UTSW 9 78,619,897 (GRCm39) missense probably benign 0.13
R0659:Cd109 UTSW 9 78,587,452 (GRCm39) splice site probably benign
R0709:Cd109 UTSW 9 78,579,260 (GRCm39) missense possibly damaging 0.93
R0840:Cd109 UTSW 9 78,571,612 (GRCm39) missense probably benign 0.04
R0909:Cd109 UTSW 9 78,543,755 (GRCm39) missense probably benign 0.01
R0945:Cd109 UTSW 9 78,596,223 (GRCm39) missense possibly damaging 0.51
R1344:Cd109 UTSW 9 78,579,832 (GRCm39) critical splice acceptor site probably null
R1471:Cd109 UTSW 9 78,561,869 (GRCm39) missense probably damaging 1.00
R1484:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R1570:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R1688:Cd109 UTSW 9 78,612,373 (GRCm39) missense probably benign 0.17
R1773:Cd109 UTSW 9 78,611,006 (GRCm39) missense probably benign 0.21
R1813:Cd109 UTSW 9 78,524,287 (GRCm39) missense probably benign 0.04
R2004:Cd109 UTSW 9 78,611,044 (GRCm39) missense probably benign 0.00
R2083:Cd109 UTSW 9 78,574,575 (GRCm39) missense probably damaging 1.00
R2483:Cd109 UTSW 9 78,574,639 (GRCm39) missense probably damaging 1.00
R2857:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2858:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2859:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2911:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2912:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2914:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2927:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3623:Cd109 UTSW 9 78,574,639 (GRCm39) missense probably damaging 1.00
R3713:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3760:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3762:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3771:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3772:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3773:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3916:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3917:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4117:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4260:Cd109 UTSW 9 78,543,745 (GRCm39) missense possibly damaging 0.67
R4387:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4389:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4526:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4527:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4528:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4700:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4708:Cd109 UTSW 9 78,579,871 (GRCm39) missense probably benign 0.00
R4723:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4750:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4751:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4754:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4755:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4773:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4984:Cd109 UTSW 9 78,541,959 (GRCm39) critical splice donor site probably null
R5259:Cd109 UTSW 9 78,617,434 (GRCm39) missense probably benign 0.30
R5353:Cd109 UTSW 9 78,617,521 (GRCm39) missense probably damaging 1.00
R5440:Cd109 UTSW 9 78,587,446 (GRCm39) critical splice donor site probably null
R5559:Cd109 UTSW 9 78,568,250 (GRCm39) missense probably benign 0.01
R5701:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R5995:Cd109 UTSW 9 78,607,561 (GRCm39) missense probably benign 0.01
R5997:Cd109 UTSW 9 78,612,344 (GRCm39) missense possibly damaging 0.93
R6103:Cd109 UTSW 9 78,605,596 (GRCm39) splice site probably null
R6174:Cd109 UTSW 9 78,572,828 (GRCm39) critical splice donor site probably null
R6410:Cd109 UTSW 9 78,564,798 (GRCm39) missense probably benign 0.01
R6529:Cd109 UTSW 9 78,619,907 (GRCm39) missense probably damaging 1.00
R6655:Cd109 UTSW 9 78,592,220 (GRCm39) missense probably benign 0.44
R6704:Cd109 UTSW 9 78,587,357 (GRCm39) missense probably benign 0.01
R6772:Cd109 UTSW 9 78,588,092 (GRCm39) missense possibly damaging 0.55
R6817:Cd109 UTSW 9 78,622,237 (GRCm39) missense probably benign 0.01
R6903:Cd109 UTSW 9 78,543,885 (GRCm39) missense probably damaging 0.97
R7294:Cd109 UTSW 9 78,619,917 (GRCm39) missense probably damaging 0.97
R7432:Cd109 UTSW 9 78,622,225 (GRCm39) missense possibly damaging 0.85
R7566:Cd109 UTSW 9 78,588,119 (GRCm39) missense probably damaging 1.00
R7767:Cd109 UTSW 9 78,617,441 (GRCm39) missense probably damaging 1.00
R7986:Cd109 UTSW 9 78,596,048 (GRCm39) missense possibly damaging 0.95
R8017:Cd109 UTSW 9 78,614,828 (GRCm39) missense possibly damaging 0.81
R8019:Cd109 UTSW 9 78,614,828 (GRCm39) missense possibly damaging 0.81
R8050:Cd109 UTSW 9 78,571,633 (GRCm39) missense probably benign 0.28
R8225:Cd109 UTSW 9 78,568,972 (GRCm39) missense probably damaging 0.99
R8269:Cd109 UTSW 9 78,572,964 (GRCm39) missense probably benign 0.06
R8479:Cd109 UTSW 9 78,574,628 (GRCm39) nonsense probably null
R8493:Cd109 UTSW 9 78,564,801 (GRCm39) missense probably benign 0.41
R8781:Cd109 UTSW 9 78,543,929 (GRCm39) missense probably damaging 1.00
R8977:Cd109 UTSW 9 78,614,810 (GRCm39) missense probably benign 0.36
R9051:Cd109 UTSW 9 78,619,813 (GRCm39) critical splice acceptor site probably benign
R9051:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R9228:Cd109 UTSW 9 78,577,042 (GRCm39) missense possibly damaging 0.93
R9366:Cd109 UTSW 9 78,622,275 (GRCm39) missense probably benign 0.11
R9430:Cd109 UTSW 9 78,574,698 (GRCm39) critical splice donor site probably null
R9572:Cd109 UTSW 9 78,567,588 (GRCm39) missense probably benign 0.16
R9691:Cd109 UTSW 9 78,611,074 (GRCm39) missense possibly damaging 0.94
R9736:Cd109 UTSW 9 78,619,918 (GRCm39) missense probably damaging 1.00
R9749:Cd109 UTSW 9 78,592,166 (GRCm39) missense probably damaging 1.00
R9751:Cd109 UTSW 9 78,605,442 (GRCm39) missense probably damaging 0.99
R9752:Cd109 UTSW 9 78,614,834 (GRCm39) missense probably benign 0.00
R9789:Cd109 UTSW 9 78,541,944 (GRCm39) missense possibly damaging 0.90
R9797:Cd109 UTSW 9 78,579,217 (GRCm39) missense probably benign 0.04
RF002:Cd109 UTSW 9 78,619,810 (GRCm39) critical splice acceptor site probably benign
RF002:Cd109 UTSW 9 78,619,805 (GRCm39) critical splice acceptor site probably benign
RF011:Cd109 UTSW 9 78,619,810 (GRCm39) critical splice acceptor site probably benign
RF013:Cd109 UTSW 9 78,619,813 (GRCm39) critical splice acceptor site probably benign
RF047:Cd109 UTSW 9 78,619,809 (GRCm39) critical splice acceptor site probably benign
RF060:Cd109 UTSW 9 78,619,807 (GRCm39) critical splice acceptor site probably benign
Z1177:Cd109 UTSW 9 78,598,595 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CGGGGACTAAGAACCATTCC -3'
(R):5'- TTTACAGACAGCCTGCCACC -3'

Sequencing Primer
(F):5'- GGGGACTAAGAACCATTCCTCTGC -3'
(R):5'- CAAAACTAACCCTGTGAGATGTC -3'
Posted On 2019-12-04