Incidental Mutation 'RF003:Med23'
Institutional Source Beutler Lab
Gene Symbol Med23
Ensembl Gene ENSMUSG00000019984
Gene Namemediator complex subunit 23
SynonymsX83317, 3000002A17Rik, ESTM7, Crsp3, Sur2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF003 (G1)
Quality Score224.009
Status Not validated
Chromosomal Location24869986-24913681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24903785 bp
Amino Acid Change Histidine to Arginine at position 920 (H920R)
Ref Sequence ENSEMBL: ENSMUSP00000090316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000177232]
Predicted Effect probably damaging
Transcript: ENSMUST00000020159
AA Change: H914R

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: H914R

Pfam:Med23 3 1310 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092646
AA Change: H920R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: H920R

Pfam:Med23 4 1316 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176285
AA Change: H554R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984
AA Change: H554R

Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177232
SMART Domains Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

Pfam:Med23 3 58 1.2e-10 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik AACC A 7: 40,993,055 probably benign Het
A630073D07Rik A C 6: 132,627,443 L13R unknown Het
Alg9 GGC GGCCGC 9: 50,775,427 probably benign Het
Arc G C 15: 74,672,131 T81S probably benign Het
Atad5 A T 11: 80,111,560 K1059N probably damaging Het
Bdp1 C A 13: 100,060,449 V1143F probably benign Het
Bdp1 C A 13: 100,060,450 Q1142H probably benign Het
Ccdc33 T C 9: 58,058,291 S583G probably benign Het
Cd109 TTAT TTATTTATTTATATAT 9: 78,712,531 probably benign Het
Cep192 A T 18: 67,837,956 R1009S probably benign Het
Clvs2 T A 10: 33,622,925 H3L probably damaging Het
Cnot6 T C 11: 49,702,613 M14V probably benign Het
Colec10 A G 15: 54,462,391 R206G possibly damaging Het
Dennd6a T C 14: 26,629,534 I598T probably damaging Het
Dmrt2 T C 19: 25,678,134 S366P probably damaging Het
Efhb T C 17: 53,400,891 D748G probably damaging Het
Etl4 C T 2: 20,519,918 Q21* probably null Het
Fam172a A T 13: 77,834,675 I135L possibly damaging Het
Fam71e1 C CGGAGGGAGGAAGGCTGGATCCTGGATACCTGGGTA 7: 44,500,527 probably null Het
Fmn1 ACCTCC ACCTCCCCCTCC 2: 113,525,786 probably benign Het
Fsip2 T A 2: 82,991,521 M5866K probably benign Het
Gab3 CTT CTTATT X: 75,000,006 probably null Het
Gnl2 T A 4: 125,043,725 probably null Het
Grip2 C T 6: 91,783,593 R341Q probably benign Het
Hmcn1 T A 1: 150,624,561 H3960L probably damaging Het
Igkv6-25 T A 6: 70,215,778 Y56* probably null Het
Il12a A T 3: 68,695,229 T102S probably benign Het
Il1a T A 2: 129,302,932 I189F possibly damaging Het
Inpp4b T A 8: 81,969,521 Y361* probably null Het
Las1l AGTGG AGTGGTGG X: 95,940,816 probably benign Het
Lrmp AGCACATTG AGCACATTGTGCACATTG 6: 145,173,783 probably benign Het
Lrrc8d T C 5: 105,812,641 Y306H probably damaging Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Map1b G T 13: 99,430,750 A1821E unknown Het
Maz A G 7: 127,025,497 C284R probably damaging Het
Mmp14 C T 14: 54,439,014 R339* probably null Het
Mroh9 T G 1: 163,058,061 K334T probably damaging Het
Nab1 A T 1: 52,479,282 C320S probably damaging Het
Noto T C 6: 85,424,210 S74P probably benign Het
Nudt4 T C 10: 95,549,374 N152D possibly damaging Het
Nup155 T TTTTG 15: 8,119,176 probably benign Het
Olfr118 A C 17: 37,672,858 K278N probably damaging Het
Olfr330 CA C 11: 58,529,157 probably null Het
Olfr461 T C 6: 40,544,362 I206V probably benign Het
Olfr585 GTTAT GTTATTAT 7: 103,098,305 Het
Olfr585 TTA TTAGTA 7: 103,098,306 probably null Het
Olfr710 T A 7: 106,944,648 M118L probably damaging Het
Olfr828 T C 9: 18,815,482 T271A probably benign Het
Plxnc1 T C 10: 94,794,444 Y1531C probably damaging Het
Pnmal2 TGA TGAAGA 7: 16,946,016 probably benign Het
Rp1 A G 1: 4,344,694 V2065A probably damaging Het
Sepsecs G A 5: 52,647,191 T379M probably benign Het
Sfswap GGCC GGCCCACTCTGCC 5: 129,569,764 probably benign Het
Six3 GCG GCGTCG 17: 85,621,370 probably benign Het
Tfeb C T 17: 47,788,078 T259I possibly damaging Het
Tgoln1 A AAACTCAG 6: 72,616,352 probably null Het
Tmem94 G A 11: 115,796,132 V1108M probably damaging Het
Usp35 T C 7: 97,322,096 K297E possibly damaging Het
Vcpkmt T A 12: 69,582,824 T55S possibly damaging Het
Zfp384 GGCCC GGCCCTGGCCCAAGCCC 6: 125,036,476 probably benign Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,036,483 probably benign Het
Zfp407 A T 18: 84,209,563 S1974T probably benign Het
Zfp677 T C 17: 21,397,442 S254P probably damaging Het
Other mutations in Med23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Med23 APN 10 24888584 missense probably damaging 1.00
IGL00792:Med23 APN 10 24877004 missense possibly damaging 0.93
IGL01289:Med23 APN 10 24902121 missense probably damaging 1.00
IGL01469:Med23 APN 10 24882597 missense probably damaging 1.00
IGL01598:Med23 APN 10 24903798 missense probably benign 0.34
IGL02324:Med23 APN 10 24897341 missense probably damaging 0.98
IGL02381:Med23 APN 10 24900728 missense possibly damaging 0.95
IGL02465:Med23 APN 10 24903743 missense probably damaging 0.96
IGL02554:Med23 APN 10 24898575 critical splice donor site probably null
IGL02683:Med23 APN 10 24870717 missense probably benign 0.00
PIT4362001:Med23 UTSW 10 24874571 missense probably benign 0.01
R0080:Med23 UTSW 10 24912817 missense probably benign 0.33
R0125:Med23 UTSW 10 24900788 missense probably damaging 1.00
R0311:Med23 UTSW 10 24897358 missense possibly damaging 0.95
R0765:Med23 UTSW 10 24900710 missense probably damaging 1.00
R1302:Med23 UTSW 10 24888422 splice site probably null
R1456:Med23 UTSW 10 24903652 splice site probably benign
R1514:Med23 UTSW 10 24892667 splice site probably benign
R1774:Med23 UTSW 10 24903686 missense probably damaging 1.00
R1851:Med23 UTSW 10 24910870 splice site probably null
R1928:Med23 UTSW 10 24909812 missense probably benign
R1975:Med23 UTSW 10 24910766 missense probably benign 0.01
R2011:Med23 UTSW 10 24879755 missense possibly damaging 0.63
R2266:Med23 UTSW 10 24874601 missense probably benign 0.00
R2309:Med23 UTSW 10 24870688 missense probably damaging 0.99
R2507:Med23 UTSW 10 24910813 missense probably damaging 1.00
R2566:Med23 UTSW 10 24888575 missense probably damaging 1.00
R3720:Med23 UTSW 10 24891120 missense probably damaging 1.00
R3771:Med23 UTSW 10 24902201 missense probably damaging 1.00
R3811:Med23 UTSW 10 24892592 nonsense probably null
R3811:Med23 UTSW 10 24892593 splice site probably null
R4305:Med23 UTSW 10 24904270 nonsense probably null
R4323:Med23 UTSW 10 24870705 missense probably benign 0.02
R4701:Med23 UTSW 10 24893648 missense probably damaging 1.00
R4886:Med23 UTSW 10 24874683 critical splice donor site probably null
R4925:Med23 UTSW 10 24910747 missense probably damaging 1.00
R4943:Med23 UTSW 10 24875669 missense possibly damaging 0.92
R5207:Med23 UTSW 10 24895836 nonsense probably null
R5749:Med23 UTSW 10 24888449 missense possibly damaging 0.84
R5806:Med23 UTSW 10 24907221 missense probably damaging 1.00
R5896:Med23 UTSW 10 24902145 missense probably damaging 1.00
R5954:Med23 UTSW 10 24870483 splice site probably benign
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6093:Med23 UTSW 10 24878443 missense probably benign 0.16
R6107:Med23 UTSW 10 24906034 nonsense probably null
R6356:Med23 UTSW 10 24888413 missense probably damaging 0.98
R6393:Med23 UTSW 10 24873476 missense possibly damaging 0.91
R6533:Med23 UTSW 10 24893620 missense probably damaging 1.00
R6911:Med23 UTSW 10 24902181 missense probably damaging 0.98
R6981:Med23 UTSW 10 24895824 missense possibly damaging 0.92
R7085:Med23 UTSW 10 24870121 missense probably damaging 1.00
R7215:Med23 UTSW 10 24888429 missense probably benign
R7229:Med23 UTSW 10 24902004 missense probably benign
R7489:Med23 UTSW 10 24904356 missense probably damaging 1.00
R7530:Med23 UTSW 10 24905953 missense probably benign 0.00
R7643:Med23 UTSW 10 24905965 missense probably benign 0.01
R7653:Med23 UTSW 10 24904384 missense probably damaging 1.00
R7764:Med23 UTSW 10 24909920 critical splice donor site probably null
R7784:Med23 UTSW 10 24902448 missense probably damaging 1.00
R8024:Med23 UTSW 10 24879683 missense possibly damaging 0.74
R8182:Med23 UTSW 10 24912807 missense probably benign
R8412:Med23 UTSW 10 24908734 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04