Incidental Mutation 'RF003:Med23'
ID 602640
Institutional Source Beutler Lab
Gene Symbol Med23
Ensembl Gene ENSMUSG00000019984
Gene Name mediator complex subunit 23
Synonyms X83317, 3000002A17Rik, ESTM7, Crsp3, Sur2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # RF003 (G1)
Quality Score 224.009
Status Not validated
Chromosome 10
Chromosomal Location 24869986-24913681 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24903785 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 920 (H920R)
Ref Sequence ENSEMBL: ENSMUSP00000090316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000177232]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000020159
AA Change: H914R

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: H914R

DomainStartEndE-ValueType
Pfam:Med23 3 1310 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092646
AA Change: H920R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: H920R

DomainStartEndE-ValueType
Pfam:Med23 4 1316 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176285
AA Change: H554R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984
AA Change: H554R

DomainStartEndE-ValueType
Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177232
SMART Domains Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 3 58 1.2e-10 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik AACC A 7: 40,993,055 probably benign Het
A630073D07Rik A C 6: 132,627,443 L13R unknown Het
Alg9 GGC GGCCGC 9: 50,775,427 probably benign Het
Arc G C 15: 74,672,131 T81S probably benign Het
Atad5 A T 11: 80,111,560 K1059N probably damaging Het
Bdp1 C A 13: 100,060,449 V1143F probably benign Het
Bdp1 C A 13: 100,060,450 Q1142H probably benign Het
Ccdc33 T C 9: 58,058,291 S583G probably benign Het
Cd109 TTAT TTATTTATTTATATAT 9: 78,712,531 probably benign Het
Cep192 A T 18: 67,837,956 R1009S probably benign Het
Clvs2 T A 10: 33,622,925 H3L probably damaging Het
Cnot6 T C 11: 49,702,613 M14V probably benign Het
Colec10 A G 15: 54,462,391 R206G possibly damaging Het
Dennd6a T C 14: 26,629,534 I598T probably damaging Het
Dmrt2 T C 19: 25,678,134 S366P probably damaging Het
Dnmt1 AGTTCCTACCTCGTT AGTTCCTACCTCGTTTTGGGGGCGGAGCACCGTTCCTACCTCGTT 9: 20,910,131 probably null Het
Efhb T C 17: 53,400,891 D748G probably damaging Het
Etl4 C T 2: 20,519,918 Q21* probably null Het
Fam172a A T 13: 77,834,675 I135L possibly damaging Het
Fam71e1 C CGGAGGGAGGAAGGCTGGATCCTGGATACCTGGGTA 7: 44,500,527 probably null Het
Flywch1 CCACTCCTGGTGT CCACTCCTGGTGTGGGGAGGCTACGTACTCACACACTCCTGGTGT 17: 23,762,166 probably null Het
Fmn1 ACCTCC ACCTCCCCCTCC 2: 113,525,786 probably benign Het
Fsip2 T A 2: 82,991,521 M5866K probably benign Het
Gab3 CTT CTTATT X: 75,000,006 probably null Het
Gnl2 T A 4: 125,043,725 probably null Het
Grip2 C T 6: 91,783,593 R341Q probably benign Het
Hmcn1 T A 1: 150,624,561 H3960L probably damaging Het
Igkv6-25 T A 6: 70,215,778 Y56* probably null Het
Il12a A T 3: 68,695,229 T102S probably benign Het
Il1a T A 2: 129,302,932 I189F possibly damaging Het
Inpp4b T A 8: 81,969,521 Y361* probably null Het
Iqcf4 CTTTTCCTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCATTTTCCTTTTCCTTTT 9: 106,570,607 probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Las1l AGTGG AGTGGTGG X: 95,940,816 probably benign Het
Lrmp AGCACATTG AGCACATTGTGCACATTG 6: 145,173,783 probably benign Het
Lrrc8d T C 5: 105,812,641 Y306H probably damaging Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,306,296 probably benign Het
Map1b G T 13: 99,430,750 A1821E unknown Het
Maz A G 7: 127,025,497 C284R probably damaging Het
Megf10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 18: 57,294,027 probably benign Het
Mmp14 C T 14: 54,439,014 R339* probably null Het
Mroh9 T G 1: 163,058,061 K334T probably damaging Het
Nab1 A T 1: 52,479,282 C320S probably damaging Het
Noto T C 6: 85,424,210 S74P probably benign Het
Nudt4 T C 10: 95,549,374 N152D possibly damaging Het
Nup155 T TTTTG 15: 8,119,176 probably benign Het
Nusap1 AGCTGAGA AGCTGAGATACACGTTAGCAGTGAGGAGCAGGCTGAGA 2: 119,627,603 probably benign Het
Olfr118 A C 17: 37,672,858 K278N probably damaging Het
Olfr330 CA C 11: 58,529,157 probably null Het
Olfr461 T C 6: 40,544,362 I206V probably benign Het
Olfr585 TTA TTAGTA 7: 103,098,306 probably null Het
Olfr585 GTTAT GTTATTAT 7: 103,098,305 Het
Olfr710 T A 7: 106,944,648 M118L probably damaging Het
Olfr828 T C 9: 18,815,482 T271A probably benign Het
Plxnc1 T C 10: 94,794,444 Y1531C probably damaging Het
Pnmal2 TGA TGAAGA 7: 16,946,016 probably benign Het
Rp1 A G 1: 4,344,694 V2065A probably damaging Het
Sbp AAGATGCTGACAACA AAGATGCTGACAACAGAGATGCTGACAACA 17: 23,945,369 probably benign Het
Sepsecs G A 5: 52,647,191 T379M probably benign Het
Sfswap GGCC GGCCCACTCTGCC 5: 129,569,764 probably benign Het
Six3 GCG GCGTCG 17: 85,621,370 probably benign Het
Tfeb C T 17: 47,788,078 T259I possibly damaging Het
Tgoln1 A AAACTCAG 6: 72,616,352 probably null Het
Tmem94 G A 11: 115,796,132 V1108M probably damaging Het
Usp35 T C 7: 97,322,096 K297E possibly damaging Het
Vcpkmt T A 12: 69,582,824 T55S possibly damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp384 GGCCC GGCCCTGGCCCAAGCCC 6: 125,036,476 probably benign Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,036,483 probably benign Het
Zfp407 A T 18: 84,209,563 S1974T probably benign Het
Zfp677 T C 17: 21,397,442 S254P probably damaging Het
Other mutations in Med23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Med23 APN 10 24888584 missense probably damaging 1.00
IGL00792:Med23 APN 10 24877004 missense possibly damaging 0.93
IGL01289:Med23 APN 10 24902121 missense probably damaging 1.00
IGL01469:Med23 APN 10 24882597 missense probably damaging 1.00
IGL01598:Med23 APN 10 24903798 missense probably benign 0.34
IGL02324:Med23 APN 10 24897341 missense probably damaging 0.98
IGL02381:Med23 APN 10 24900728 missense possibly damaging 0.95
IGL02465:Med23 APN 10 24903743 missense probably damaging 0.96
IGL02554:Med23 APN 10 24898575 critical splice donor site probably null
IGL02683:Med23 APN 10 24870717 missense probably benign 0.00
PIT4362001:Med23 UTSW 10 24874571 missense probably benign 0.01
R0080:Med23 UTSW 10 24912817 missense probably benign 0.33
R0125:Med23 UTSW 10 24900788 missense probably damaging 1.00
R0311:Med23 UTSW 10 24897358 missense possibly damaging 0.95
R0765:Med23 UTSW 10 24900710 missense probably damaging 1.00
R1302:Med23 UTSW 10 24888422 splice site probably null
R1456:Med23 UTSW 10 24903652 splice site probably benign
R1514:Med23 UTSW 10 24892667 splice site probably benign
R1774:Med23 UTSW 10 24903686 missense probably damaging 1.00
R1851:Med23 UTSW 10 24910870 splice site probably null
R1928:Med23 UTSW 10 24909812 missense probably benign
R1975:Med23 UTSW 10 24910766 missense probably benign 0.01
R2011:Med23 UTSW 10 24879755 missense possibly damaging 0.63
R2266:Med23 UTSW 10 24874601 missense probably benign 0.00
R2309:Med23 UTSW 10 24870688 missense probably damaging 0.99
R2507:Med23 UTSW 10 24910813 missense probably damaging 1.00
R2566:Med23 UTSW 10 24888575 missense probably damaging 1.00
R3720:Med23 UTSW 10 24891120 missense probably damaging 1.00
R3771:Med23 UTSW 10 24902201 missense probably damaging 1.00
R3811:Med23 UTSW 10 24892592 nonsense probably null
R3811:Med23 UTSW 10 24892593 splice site probably null
R4305:Med23 UTSW 10 24904270 nonsense probably null
R4323:Med23 UTSW 10 24870705 missense probably benign 0.02
R4701:Med23 UTSW 10 24893648 missense probably damaging 1.00
R4886:Med23 UTSW 10 24874683 critical splice donor site probably null
R4925:Med23 UTSW 10 24910747 missense probably damaging 1.00
R4943:Med23 UTSW 10 24875669 missense possibly damaging 0.92
R5207:Med23 UTSW 10 24895836 nonsense probably null
R5749:Med23 UTSW 10 24888449 missense possibly damaging 0.84
R5806:Med23 UTSW 10 24907221 missense probably damaging 1.00
R5896:Med23 UTSW 10 24902145 missense probably damaging 1.00
R5954:Med23 UTSW 10 24870483 splice site probably benign
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6093:Med23 UTSW 10 24878443 missense probably benign 0.16
R6107:Med23 UTSW 10 24906034 nonsense probably null
R6356:Med23 UTSW 10 24888413 missense probably damaging 0.98
R6393:Med23 UTSW 10 24873476 missense possibly damaging 0.91
R6533:Med23 UTSW 10 24893620 missense probably damaging 1.00
R6911:Med23 UTSW 10 24902181 missense probably damaging 0.98
R6981:Med23 UTSW 10 24895824 missense possibly damaging 0.92
R7085:Med23 UTSW 10 24870121 missense probably damaging 1.00
R7215:Med23 UTSW 10 24888429 missense probably benign
R7229:Med23 UTSW 10 24902004 missense probably benign
R7489:Med23 UTSW 10 24904356 missense probably damaging 1.00
R7530:Med23 UTSW 10 24905953 missense probably benign 0.00
R7643:Med23 UTSW 10 24905965 missense probably benign 0.01
R7653:Med23 UTSW 10 24904384 missense probably damaging 1.00
R7764:Med23 UTSW 10 24909920 critical splice donor site probably null
R7784:Med23 UTSW 10 24902448 missense probably damaging 1.00
R8024:Med23 UTSW 10 24879683 missense possibly damaging 0.74
R8182:Med23 UTSW 10 24912807 missense probably benign
R8412:Med23 UTSW 10 24908734 missense probably benign 0.01
R8874:Med23 UTSW 10 24895719 missense possibly damaging 0.92
R8975:Med23 UTSW 10 24904436 missense probably benign 0.42
R9131:Med23 UTSW 10 24904381 missense
R9202:Med23 UTSW 10 24904304 missense probably benign 0.12
R9341:Med23 UTSW 10 24912807 missense probably benign
R9342:Med23 UTSW 10 24874571 missense probably benign 0.01
R9343:Med23 UTSW 10 24912807 missense probably benign
R9412:Med23 UTSW 10 24902121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTTGGGGTAGACTAGACATC -3'
(R):5'- CATGCCGACTTGAAGTACAGTTAC -3'

Sequencing Primer
(F):5'- TTTGGGGTAGACTAGACATCTAAGG -3'
(R):5'- CTTATTCATTAGCATAGCCTACAGC -3'
Posted On 2019-12-04