Incidental Mutation 'RF003:Dennd6a'
Institutional Source Beutler Lab
Gene Symbol Dennd6a
Ensembl Gene ENSMUSG00000040818
Gene NameDENN/MADD domain containing 6A
SynonymsA630054L15Rik, Fam116a
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #RF003 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location26573856-26634322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26629534 bp
Amino Acid Change Isoleucine to Threonine at position 598 (I598T)
Ref Sequence ENSEMBL: ENSMUSP00000039361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037585] [ENSMUST00000203874] [ENSMUST00000224111] [ENSMUST00000224248] [ENSMUST00000224378]
Predicted Effect probably damaging
Transcript: ENSMUST00000037585
AA Change: I598T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039361
Gene: ENSMUSG00000040818
AA Change: I598T

low complexity region 17 51 N/A INTRINSIC
Pfam:Avl9 59 200 2.9e-11 PFAM
Pfam:DENN 165 371 1.1e-7 PFAM
Pfam:SPA 265 373 4.2e-18 PFAM
low complexity region 379 390 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 526 541 N/A INTRINSIC
low complexity region 554 563 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203874
SMART Domains Protein: ENSMUSP00000144906
Gene: ENSMUSG00000040818

low complexity region 17 51 N/A INTRINSIC
Pfam:Avl9 59 200 2.6e-11 PFAM
Pfam:DENN 165 371 9.7e-8 PFAM
Pfam:SPA 265 373 3.7e-18 PFAM
low complexity region 379 390 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000224111
AA Change: I374T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000224248
AA Change: I374T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000224378
AA Change: I248T

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik AACC A 7: 40,993,055 probably benign Het
A630073D07Rik A C 6: 132,627,443 L13R unknown Het
Alg9 GGC GGCCGC 9: 50,775,427 probably benign Het
Arc G C 15: 74,672,131 T81S probably benign Het
Atad5 A T 11: 80,111,560 K1059N probably damaging Het
Bdp1 C A 13: 100,060,449 V1143F probably benign Het
Bdp1 C A 13: 100,060,450 Q1142H probably benign Het
Ccdc33 T C 9: 58,058,291 S583G probably benign Het
Cd109 TTAT TTATTTATTTATATAT 9: 78,712,531 probably benign Het
Cep192 A T 18: 67,837,956 R1009S probably benign Het
Clvs2 T A 10: 33,622,925 H3L probably damaging Het
Cnot6 T C 11: 49,702,613 M14V probably benign Het
Colec10 A G 15: 54,462,391 R206G possibly damaging Het
Dmrt2 T C 19: 25,678,134 S366P probably damaging Het
Efhb T C 17: 53,400,891 D748G probably damaging Het
Etl4 C T 2: 20,519,918 Q21* probably null Het
Fam172a A T 13: 77,834,675 I135L possibly damaging Het
Fam71e1 C CGGAGGGAGGAAGGCTGGATCCTGGATACCTGGGTA 7: 44,500,527 probably null Het
Fmn1 ACCTCC ACCTCCCCCTCC 2: 113,525,786 probably benign Het
Fsip2 T A 2: 82,991,521 M5866K probably benign Het
Gab3 CTT CTTATT X: 75,000,006 probably null Het
Gnl2 T A 4: 125,043,725 probably null Het
Grip2 C T 6: 91,783,593 R341Q probably benign Het
Hmcn1 T A 1: 150,624,561 H3960L probably damaging Het
Igkv6-25 T A 6: 70,215,778 Y56* probably null Het
Il12a A T 3: 68,695,229 T102S probably benign Het
Il1a T A 2: 129,302,932 I189F possibly damaging Het
Inpp4b T A 8: 81,969,521 Y361* probably null Het
Las1l AGTGG AGTGGTGG X: 95,940,816 probably benign Het
Lrmp AGCACATTG AGCACATTGTGCACATTG 6: 145,173,783 probably benign Het
Lrrc8d T C 5: 105,812,641 Y306H probably damaging Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Map1b G T 13: 99,430,750 A1821E unknown Het
Maz A G 7: 127,025,497 C284R probably damaging Het
Med23 A G 10: 24,903,785 H920R probably damaging Het
Mmp14 C T 14: 54,439,014 R339* probably null Het
Mroh9 T G 1: 163,058,061 K334T probably damaging Het
Nab1 A T 1: 52,479,282 C320S probably damaging Het
Noto T C 6: 85,424,210 S74P probably benign Het
Nudt4 T C 10: 95,549,374 N152D possibly damaging Het
Nup155 T TTTTG 15: 8,119,176 probably benign Het
Olfr118 A C 17: 37,672,858 K278N probably damaging Het
Olfr330 CA C 11: 58,529,157 probably null Het
Olfr461 T C 6: 40,544,362 I206V probably benign Het
Olfr585 GTTAT GTTATTAT 7: 103,098,305 Het
Olfr585 TTA TTAGTA 7: 103,098,306 probably null Het
Olfr710 T A 7: 106,944,648 M118L probably damaging Het
Olfr828 T C 9: 18,815,482 T271A probably benign Het
Plxnc1 T C 10: 94,794,444 Y1531C probably damaging Het
Pnmal2 TGA TGAAGA 7: 16,946,016 probably benign Het
Rp1 A G 1: 4,344,694 V2065A probably damaging Het
Sepsecs G A 5: 52,647,191 T379M probably benign Het
Sfswap GGCC GGCCCACTCTGCC 5: 129,569,764 probably benign Het
Six3 GCG GCGTCG 17: 85,621,370 probably benign Het
Tfeb C T 17: 47,788,078 T259I possibly damaging Het
Tgoln1 A AAACTCAG 6: 72,616,352 probably null Het
Tmem94 G A 11: 115,796,132 V1108M probably damaging Het
Usp35 T C 7: 97,322,096 K297E possibly damaging Het
Vcpkmt T A 12: 69,582,824 T55S possibly damaging Het
Zfp384 GGCCC GGCCCTGGCCCAAGCCC 6: 125,036,476 probably benign Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,036,483 probably benign Het
Zfp407 A T 18: 84,209,563 S1974T probably benign Het
Zfp677 T C 17: 21,397,442 S254P probably damaging Het
Other mutations in Dennd6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Dennd6a APN 14 26608613 missense probably damaging 1.00
IGL01011:Dennd6a APN 14 26603054 missense probably damaging 0.99
IGL01395:Dennd6a APN 14 26616901 nonsense probably null
IGL01559:Dennd6a APN 14 26608565 missense probably damaging 1.00
IGL01590:Dennd6a APN 14 26619352 missense probably benign 0.40
IGL02187:Dennd6a APN 14 26606926 missense probably benign
IGL03296:Dennd6a APN 14 26616960 critical splice donor site probably null
R1831:Dennd6a UTSW 14 26606954 missense probably damaging 1.00
R1833:Dennd6a UTSW 14 26606954 missense probably damaging 1.00
R2020:Dennd6a UTSW 14 26612003 missense probably damaging 0.99
R2032:Dennd6a UTSW 14 26604749 missense probably benign 0.42
R2036:Dennd6a UTSW 14 26608119 missense probably damaging 0.99
R3707:Dennd6a UTSW 14 26592391 splice site probably benign
R4112:Dennd6a UTSW 14 26628518 intron probably benign
R4728:Dennd6a UTSW 14 26627420 missense probably null 1.00
R5053:Dennd6a UTSW 14 26608583 missense probably damaging 1.00
R5760:Dennd6a UTSW 14 26612040 missense probably damaging 0.99
R5774:Dennd6a UTSW 14 26579819 missense probably benign
R5775:Dennd6a UTSW 14 26619373 nonsense probably null
R6238:Dennd6a UTSW 14 26616658 critical splice donor site probably null
R6446:Dennd6a UTSW 14 26629534 missense probably damaging 1.00
R6734:Dennd6a UTSW 14 26608619 missense possibly damaging 0.84
R7289:Dennd6a UTSW 14 26612038 missense probably damaging 1.00
R7436:Dennd6a UTSW 14 26579710 nonsense probably null
R7887:Dennd6a UTSW 14 26599657 missense possibly damaging 0.50
R7970:Dennd6a UTSW 14 26599657 missense possibly damaging 0.50
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04