Incidental Mutation 'RF003:Krt1'
ID602658
Institutional Source Beutler Lab
Gene Symbol Krt1
Ensembl Gene ENSMUSG00000046834
Gene Namekeratin 1
SynonymsKrt-2.1, Krt2-1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.409) question?
Stock #RF003 (G1)
Quality Score214.458
Status Not validated
Chromosome15
Chromosomal Location101845426-101850794 bp(-) (GRCm38)
Type of Mutationsmall deletion (10 aa in frame mutation)
DNA Base Change (assembly) AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC at 101850378 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023790]
Predicted Effect probably benign
Transcript: ENSMUST00000023790
SMART Domains Protein: ENSMUSP00000023790
Gene: ENSMUSG00000046834

DomainStartEndE-ValueType
Pfam:Keratin_2_head 19 184 7.5e-35 PFAM
Filament 187 500 1.02e-154 SMART
Pfam:Keratin_2_tail 501 633 7.6e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231047
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the spinous and granular layers of the epidermis with family member KRT10 and mutations in these genes have been associated with bullous congenital ichthyosiform erythroderma. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a dominant mutation exhibit significant blistering and skin erosions at birth and develop severe hyperkeratosis as adults. Mice homozygous for the dominant mutation also exhibit blistering, and die before weaning age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik AACC A 7: 40,993,055 probably benign Het
A630073D07Rik A C 6: 132,627,443 L13R unknown Het
Alg9 GGC GGCCGC 9: 50,775,427 probably benign Het
Arc G C 15: 74,672,131 T81S probably benign Het
Atad5 A T 11: 80,111,560 K1059N probably damaging Het
Bdp1 C A 13: 100,060,449 V1143F probably benign Het
Bdp1 C A 13: 100,060,450 Q1142H probably benign Het
Ccdc33 T C 9: 58,058,291 S583G probably benign Het
Cd109 TTAT TTATTTATTTATATAT 9: 78,712,531 probably benign Het
Cep192 A T 18: 67,837,956 R1009S probably benign Het
Clvs2 T A 10: 33,622,925 H3L probably damaging Het
Cnot6 T C 11: 49,702,613 M14V probably benign Het
Colec10 A G 15: 54,462,391 R206G possibly damaging Het
Dennd6a T C 14: 26,629,534 I598T probably damaging Het
Dmrt2 T C 19: 25,678,134 S366P probably damaging Het
Dnmt1 AGTTCCTACCTCGTT AGTTCCTACCTCGTTTTGGGGGCGGAGCACCGTTCCTACCTCGTT 9: 20,910,131 probably null Het
Efhb T C 17: 53,400,891 D748G probably damaging Het
Etl4 C T 2: 20,519,918 Q21* probably null Het
Fam172a A T 13: 77,834,675 I135L possibly damaging Het
Fam71e1 C CGGAGGGAGGAAGGCTGGATCCTGGATACCTGGGTA 7: 44,500,527 probably null Het
Flywch1 CCACTCCTGGTGT CCACTCCTGGTGTGGGGAGGCTACGTACTCACACACTCCTGGTGT 17: 23,762,166 probably null Het
Fmn1 ACCTCC ACCTCCCCCTCC 2: 113,525,786 probably benign Het
Fsip2 T A 2: 82,991,521 M5866K probably benign Het
Gab3 CTT CTTATT X: 75,000,006 probably null Het
Gnl2 T A 4: 125,043,725 probably null Het
Grip2 C T 6: 91,783,593 R341Q probably benign Het
Hmcn1 T A 1: 150,624,561 H3960L probably damaging Het
Igkv6-25 T A 6: 70,215,778 Y56* probably null Het
Il12a A T 3: 68,695,229 T102S probably benign Het
Il1a T A 2: 129,302,932 I189F possibly damaging Het
Inpp4b T A 8: 81,969,521 Y361* probably null Het
Iqcf4 CTTTTCCTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCATTTTCCTTTTCCTTTT 9: 106,570,607 probably benign Het
Las1l AGTGG AGTGGTGG X: 95,940,816 probably benign Het
Lrmp AGCACATTG AGCACATTGTGCACATTG 6: 145,173,783 probably benign Het
Lrrc8d T C 5: 105,812,641 Y306H probably damaging Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,306,296 probably benign Het
Map1b G T 13: 99,430,750 A1821E unknown Het
Maz A G 7: 127,025,497 C284R probably damaging Het
Med23 A G 10: 24,903,785 H920R probably damaging Het
Megf10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 18: 57,294,027 probably benign Het
Mmp14 C T 14: 54,439,014 R339* probably null Het
Mroh9 T G 1: 163,058,061 K334T probably damaging Het
Nab1 A T 1: 52,479,282 C320S probably damaging Het
Noto T C 6: 85,424,210 S74P probably benign Het
Nudt4 T C 10: 95,549,374 N152D possibly damaging Het
Nup155 T TTTTG 15: 8,119,176 probably benign Het
Nusap1 AGCTGAGA AGCTGAGATACACGTTAGCAGTGAGGAGCAGGCTGAGA 2: 119,627,603 probably benign Het
Olfr118 A C 17: 37,672,858 K278N probably damaging Het
Olfr330 CA C 11: 58,529,157 probably null Het
Olfr461 T C 6: 40,544,362 I206V probably benign Het
Olfr585 GTTAT GTTATTAT 7: 103,098,305 Het
Olfr585 TTA TTAGTA 7: 103,098,306 probably null Het
Olfr710 T A 7: 106,944,648 M118L probably damaging Het
Olfr828 T C 9: 18,815,482 T271A probably benign Het
Plxnc1 T C 10: 94,794,444 Y1531C probably damaging Het
Pnmal2 TGA TGAAGA 7: 16,946,016 probably benign Het
Rp1 A G 1: 4,344,694 V2065A probably damaging Het
Sbp AAGATGCTGACAACA AAGATGCTGACAACAGAGATGCTGACAACA 17: 23,945,369 probably benign Het
Sepsecs G A 5: 52,647,191 T379M probably benign Het
Sfswap GGCC GGCCCACTCTGCC 5: 129,569,764 probably benign Het
Six3 GCG GCGTCG 17: 85,621,370 probably benign Het
Tfeb C T 17: 47,788,078 T259I possibly damaging Het
Tgoln1 A AAACTCAG 6: 72,616,352 probably null Het
Tmem94 G A 11: 115,796,132 V1108M probably damaging Het
Usp35 T C 7: 97,322,096 K297E possibly damaging Het
Vcpkmt T A 12: 69,582,824 T55S possibly damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp384 GGCCC GGCCCTGGCCCAAGCCC 6: 125,036,476 probably benign Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,036,483 probably benign Het
Zfp407 A T 18: 84,209,563 S1974T probably benign Het
Zfp677 T C 17: 21,397,442 S254P probably damaging Het
Other mutations in Krt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Krt1 APN 15 101848193 missense probably damaging 1.00
IGL01478:Krt1 APN 15 101846286 splice site probably benign
IGL01919:Krt1 APN 15 101846376 missense unknown
IGL01970:Krt1 APN 15 101846864 missense possibly damaging 0.95
IGL02207:Krt1 APN 15 101848616 missense possibly damaging 0.94
IGL02643:Krt1 APN 15 101847044 missense probably benign 0.26
R0445:Krt1 UTSW 15 101847621 missense probably damaging 1.00
R0683:Krt1 UTSW 15 101850466 missense unknown
R1006:Krt1 UTSW 15 101847891 missense possibly damaging 0.96
R1163:Krt1 UTSW 15 101848165 nonsense probably null
R1217:Krt1 UTSW 15 101848981 missense possibly damaging 0.90
R1325:Krt1 UTSW 15 101848206 splice site probably null
R1965:Krt1 UTSW 15 101848992 missense probably benign 0.13
R1966:Krt1 UTSW 15 101848992 missense probably benign 0.13
R2101:Krt1 UTSW 15 101846187 missense unknown
R2302:Krt1 UTSW 15 101846187 missense unknown
R2697:Krt1 UTSW 15 101846929 missense probably damaging 1.00
R3034:Krt1 UTSW 15 101850633 missense unknown
R3079:Krt1 UTSW 15 101846187 missense unknown
R3080:Krt1 UTSW 15 101846187 missense unknown
R3891:Krt1 UTSW 15 101850412 missense unknown
R3892:Krt1 UTSW 15 101850412 missense unknown
R4180:Krt1 UTSW 15 101850378 small deletion probably benign
R4305:Krt1 UTSW 15 101850378 small deletion probably benign
R4334:Krt1 UTSW 15 101850378 small deletion probably benign
R4597:Krt1 UTSW 15 101847628 missense possibly damaging 0.90
R4625:Krt1 UTSW 15 101846187 missense unknown
R4626:Krt1 UTSW 15 101846187 missense unknown
R4628:Krt1 UTSW 15 101846187 missense unknown
R4629:Krt1 UTSW 15 101846187 missense unknown
R4630:Krt1 UTSW 15 101846187 missense unknown
R4631:Krt1 UTSW 15 101846187 missense unknown
R4632:Krt1 UTSW 15 101846187 missense unknown
R4633:Krt1 UTSW 15 101846187 missense unknown
R4893:Krt1 UTSW 15 101850120 missense probably damaging 1.00
R4948:Krt1 UTSW 15 101845941 missense unknown
R5193:Krt1 UTSW 15 101845922 missense unknown
R5254:Krt1 UTSW 15 101846368 missense unknown
R5448:Krt1 UTSW 15 101849029 nonsense probably null
R5494:Krt1 UTSW 15 101850714 missense unknown
R5567:Krt1 UTSW 15 101846905 missense probably benign 0.12
R5570:Krt1 UTSW 15 101846905 missense probably benign 0.12
R5869:Krt1 UTSW 15 101850131 missense probably damaging 1.00
R6200:Krt1 UTSW 15 101850378 small deletion probably benign
R6224:Krt1 UTSW 15 101850267 missense possibly damaging 0.92
R6326:Krt1 UTSW 15 101850249 missense probably damaging 1.00
R6517:Krt1 UTSW 15 101850267 missense possibly damaging 0.92
R6525:Krt1 UTSW 15 101850378 small deletion probably benign
R6918:Krt1 UTSW 15 101850177 missense probably damaging 1.00
R7018:Krt1 UTSW 15 101850378 small deletion probably benign
R7040:Krt1 UTSW 15 101850378 small deletion probably benign
R7110:Krt1 UTSW 15 101850378 small deletion probably benign
R7296:Krt1 UTSW 15 101850629 missense unknown
R7368:Krt1 UTSW 15 101846872 missense probably damaging 1.00
R7549:Krt1 UTSW 15 101850378 small deletion probably benign
R7706:Krt1 UTSW 15 101850378 small deletion probably benign
X0067:Krt1 UTSW 15 101847755 critical splice donor site probably null
Z1177:Krt1 UTSW 15 101846016 missense unknown
Z1177:Krt1 UTSW 15 101850535 missense unknown
Predicted Primers PCR Primer
(F):5'- TCAACGTTGAGGGGTTGCAG -3'
(R):5'- ATCCACCAGCAGCTCTATGC -3'

Sequencing Primer
(F):5'- CAGAAGGCTTTGGTTGATGGTCAC -3'
(R):5'- AGATTTTCAGGAGGAGGCTTC -3'
Posted On2019-12-04