Incidental Mutation 'RF003:Zfp677'
ID602659
Institutional Source Beutler Lab
Gene Symbol Zfp677
Ensembl Gene ENSMUSG00000062743
Gene Namezinc finger protein 677
SynonymsA830058L05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #RF003 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location21383748-21399265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21397442 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 254 (S254P)
Ref Sequence ENSEMBL: ENSMUSP00000052667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056107] [ENSMUST00000162659]
Predicted Effect probably damaging
Transcript: ENSMUST00000056107
AA Change: S254P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052667
Gene: ENSMUSG00000062743
AA Change: S254P

DomainStartEndE-ValueType
KRAB 13 75 1.11e-21 SMART
ZnF_C2H2 185 207 2.95e-3 SMART
ZnF_C2H2 213 235 3.95e-4 SMART
ZnF_C2H2 241 263 2.09e-3 SMART
ZnF_C2H2 269 291 6.42e-4 SMART
ZnF_C2H2 297 319 5.5e-3 SMART
ZnF_C2H2 325 347 1.98e-4 SMART
ZnF_C2H2 353 375 1.98e-4 SMART
ZnF_C2H2 381 403 1.47e-3 SMART
ZnF_C2H2 409 431 1.28e-3 SMART
ZnF_C2H2 437 459 3.95e-4 SMART
ZnF_C2H2 465 487 1.04e-3 SMART
ZnF_C2H2 493 515 8.47e-4 SMART
ZnF_C2H2 521 543 7.49e-5 SMART
ZnF_C2H2 549 571 1.18e-2 SMART
ZnF_C2H2 577 599 6.08e-5 SMART
ZnF_C2H2 610 632 4.17e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162659
AA Change: S254P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125295
Gene: ENSMUSG00000062743
AA Change: S254P

DomainStartEndE-ValueType
KRAB 13 75 1.11e-21 SMART
Pfam:zf-H2C2_2 118 140 2.9e-5 PFAM
ZnF_C2H2 185 207 2.95e-3 SMART
ZnF_C2H2 213 235 3.95e-4 SMART
ZnF_C2H2 241 263 2.09e-3 SMART
ZnF_C2H2 269 291 6.42e-4 SMART
ZnF_C2H2 297 319 5.5e-3 SMART
ZnF_C2H2 325 347 1.98e-4 SMART
ZnF_C2H2 353 375 1.98e-4 SMART
ZnF_C2H2 381 403 1.47e-3 SMART
ZnF_C2H2 409 431 1.28e-3 SMART
ZnF_C2H2 437 459 3.95e-4 SMART
ZnF_C2H2 465 487 1.04e-3 SMART
ZnF_C2H2 493 515 8.47e-4 SMART
ZnF_C2H2 521 543 7.49e-5 SMART
ZnF_C2H2 549 571 1.18e-2 SMART
ZnF_C2H2 577 599 6.08e-5 SMART
ZnF_C2H2 610 632 4.17e-3 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik AACC A 7: 40,993,055 probably benign Het
A630073D07Rik A C 6: 132,627,443 L13R unknown Het
Alg9 GGC GGCCGC 9: 50,775,427 probably benign Het
Arc G C 15: 74,672,131 T81S probably benign Het
Atad5 A T 11: 80,111,560 K1059N probably damaging Het
Bdp1 C A 13: 100,060,449 V1143F probably benign Het
Bdp1 C A 13: 100,060,450 Q1142H probably benign Het
Ccdc33 T C 9: 58,058,291 S583G probably benign Het
Cd109 TTAT TTATTTATTTATATAT 9: 78,712,531 probably benign Het
Cep192 A T 18: 67,837,956 R1009S probably benign Het
Clvs2 T A 10: 33,622,925 H3L probably damaging Het
Cnot6 T C 11: 49,702,613 M14V probably benign Het
Colec10 A G 15: 54,462,391 R206G possibly damaging Het
Dennd6a T C 14: 26,629,534 I598T probably damaging Het
Dmrt2 T C 19: 25,678,134 S366P probably damaging Het
Dnmt1 AGTTCCTACCTCGTT AGTTCCTACCTCGTTTTGGGGGCGGAGCACCGTTCCTACCTCGTT 9: 20,910,131 probably null Het
Efhb T C 17: 53,400,891 D748G probably damaging Het
Etl4 C T 2: 20,519,918 Q21* probably null Het
Fam172a A T 13: 77,834,675 I135L possibly damaging Het
Fam71e1 C CGGAGGGAGGAAGGCTGGATCCTGGATACCTGGGTA 7: 44,500,527 probably null Het
Flywch1 CCACTCCTGGTGT CCACTCCTGGTGTGGGGAGGCTACGTACTCACACACTCCTGGTGT 17: 23,762,166 probably null Het
Fmn1 ACCTCC ACCTCCCCCTCC 2: 113,525,786 probably benign Het
Fsip2 T A 2: 82,991,521 M5866K probably benign Het
Gab3 CTT CTTATT X: 75,000,006 probably null Het
Gnl2 T A 4: 125,043,725 probably null Het
Grip2 C T 6: 91,783,593 R341Q probably benign Het
Hmcn1 T A 1: 150,624,561 H3960L probably damaging Het
Igkv6-25 T A 6: 70,215,778 Y56* probably null Het
Il12a A T 3: 68,695,229 T102S probably benign Het
Il1a T A 2: 129,302,932 I189F possibly damaging Het
Inpp4b T A 8: 81,969,521 Y361* probably null Het
Iqcf4 CTTTTCCTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCATTTTCCTTTTCCTTTT 9: 106,570,607 probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Las1l AGTGG AGTGGTGG X: 95,940,816 probably benign Het
Lrmp AGCACATTG AGCACATTGTGCACATTG 6: 145,173,783 probably benign Het
Lrrc8d T C 5: 105,812,641 Y306H probably damaging Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,306,296 probably benign Het
Map1b G T 13: 99,430,750 A1821E unknown Het
Maz A G 7: 127,025,497 C284R probably damaging Het
Med23 A G 10: 24,903,785 H920R probably damaging Het
Megf10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 18: 57,294,027 probably benign Het
Mmp14 C T 14: 54,439,014 R339* probably null Het
Mroh9 T G 1: 163,058,061 K334T probably damaging Het
Nab1 A T 1: 52,479,282 C320S probably damaging Het
Noto T C 6: 85,424,210 S74P probably benign Het
Nudt4 T C 10: 95,549,374 N152D possibly damaging Het
Nup155 T TTTTG 15: 8,119,176 probably benign Het
Nusap1 AGCTGAGA AGCTGAGATACACGTTAGCAGTGAGGAGCAGGCTGAGA 2: 119,627,603 probably benign Het
Olfr118 A C 17: 37,672,858 K278N probably damaging Het
Olfr330 CA C 11: 58,529,157 probably null Het
Olfr461 T C 6: 40,544,362 I206V probably benign Het
Olfr585 TTA TTAGTA 7: 103,098,306 probably null Het
Olfr585 GTTAT GTTATTAT 7: 103,098,305 Het
Olfr710 T A 7: 106,944,648 M118L probably damaging Het
Olfr828 T C 9: 18,815,482 T271A probably benign Het
Plxnc1 T C 10: 94,794,444 Y1531C probably damaging Het
Pnmal2 TGA TGAAGA 7: 16,946,016 probably benign Het
Rp1 A G 1: 4,344,694 V2065A probably damaging Het
Sbp AAGATGCTGACAACA AAGATGCTGACAACAGAGATGCTGACAACA 17: 23,945,369 probably benign Het
Sepsecs G A 5: 52,647,191 T379M probably benign Het
Sfswap GGCC GGCCCACTCTGCC 5: 129,569,764 probably benign Het
Six3 GCG GCGTCG 17: 85,621,370 probably benign Het
Tfeb C T 17: 47,788,078 T259I possibly damaging Het
Tgoln1 A AAACTCAG 6: 72,616,352 probably null Het
Tmem94 G A 11: 115,796,132 V1108M probably damaging Het
Usp35 T C 7: 97,322,096 K297E possibly damaging Het
Vcpkmt T A 12: 69,582,824 T55S possibly damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp384 GGCCC GGCCCTGGCCCAAGCCC 6: 125,036,476 probably benign Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,036,483 probably benign Het
Zfp407 A T 18: 84,209,563 S1974T probably benign Het
Other mutations in Zfp677
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Zfp677 APN 17 21397668 missense probably benign 0.33
IGL01973:Zfp677 APN 17 21396907 missense probably damaging 1.00
IGL02206:Zfp677 APN 17 21393237 missense probably damaging 1.00
IGL03240:Zfp677 APN 17 21396873 missense probably damaging 0.99
IGL03409:Zfp677 APN 17 21396845 missense probably damaging 1.00
R0622:Zfp677 UTSW 17 21397700 missense probably benign 0.04
R0972:Zfp677 UTSW 17 21398310 missense probably damaging 1.00
R1519:Zfp677 UTSW 17 21397237 missense possibly damaging 0.91
R2155:Zfp677 UTSW 17 21397708 missense probably benign 0.01
R2316:Zfp677 UTSW 17 21397320 missense probably benign 0.38
R2866:Zfp677 UTSW 17 21397256 nonsense probably null
R2989:Zfp677 UTSW 17 21396852 missense probably benign 0.11
R3955:Zfp677 UTSW 17 21397817 missense possibly damaging 0.95
R4075:Zfp677 UTSW 17 21398159 missense probably damaging 1.00
R4134:Zfp677 UTSW 17 21397781 missense probably benign 0.01
R4229:Zfp677 UTSW 17 21398282 missense probably damaging 1.00
R4729:Zfp677 UTSW 17 21397418 missense possibly damaging 0.51
R4843:Zfp677 UTSW 17 21392526 missense probably benign 0.23
R5023:Zfp677 UTSW 17 21397794 missense probably damaging 1.00
R5316:Zfp677 UTSW 17 21397148 missense probably damaging 0.99
R5420:Zfp677 UTSW 17 21397913 missense probably damaging 1.00
R5694:Zfp677 UTSW 17 21397759 missense probably damaging 0.99
R5837:Zfp677 UTSW 17 21397386 missense probably damaging 1.00
R5888:Zfp677 UTSW 17 21398258 missense probably damaging 1.00
R6007:Zfp677 UTSW 17 21397656 missense probably damaging 1.00
R6119:Zfp677 UTSW 17 21397808 missense possibly damaging 0.55
R6190:Zfp677 UTSW 17 21397268 missense possibly damaging 0.91
R6518:Zfp677 UTSW 17 21398130 missense probably damaging 1.00
R7198:Zfp677 UTSW 17 21398417 missense probably damaging 1.00
R7391:Zfp677 UTSW 17 21398391 missense possibly damaging 0.56
R7801:Zfp677 UTSW 17 21398015 missense probably damaging 1.00
R7808:Zfp677 UTSW 17 21397385 missense probably damaging 1.00
R8202:Zfp677 UTSW 17 21393273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTACACACAGACTGATGC -3'
(R):5'- GCACATTGTCTAAAGGATCTGTC -3'

Sequencing Primer
(F):5'- GTGGAAAATGCTTCAGTACTTCCTCG -3'
(R):5'- CTGTCACAAACATTGCACGTGTAGG -3'
Posted On2019-12-04