Incidental Mutation 'RF003:Tfeb'
ID 602663
Institutional Source Beutler Lab
Gene Symbol Tfeb
Ensembl Gene ENSMUSG00000023990
Gene Name transcription factor EB
Synonyms Tcfeb, TFEB, bHLHe35
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF003 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 48047962-48103341 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 48099003 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 259 (T259I)
Ref Sequence ENSEMBL: ENSMUSP00000024786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024786] [ENSMUST00000086932] [ENSMUST00000113284] [ENSMUST00000113288] [ENSMUST00000125177] [ENSMUST00000126258] [ENSMUST00000130208] [ENSMUST00000137845] [ENSMUST00000141631] [ENSMUST00000146782] [ENSMUST00000159641] [ENSMUST00000160373]
AlphaFold Q9R210
Predicted Effect possibly damaging
Transcript: ENSMUST00000024786
AA Change: T259I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000024786
Gene: ENSMUSG00000023990
AA Change: T259I

DomainStartEndE-ValueType
Pfam:MITF_TFEB_C_3_N 63 220 2e-69 PFAM
HLH 299 352 1.44e-15 SMART
Pfam:DUF3371 379 531 1.8e-39 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000086932
AA Change: T200I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000084151
Gene: ENSMUSG00000023990
AA Change: T200I

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
HLH 240 293 1.44e-15 SMART
Pfam:DUF3371 320 473 7e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113284
AA Change: T200I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108909
Gene: ENSMUSG00000023990
AA Change: T200I

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
Pfam:HLH 235 266 1.4e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113288
AA Change: T200I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108913
Gene: ENSMUSG00000023990
AA Change: T200I

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
HLH 240 293 1.44e-15 SMART
Pfam:DUF3371 320 473 7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125177
SMART Domains Protein: ENSMUSP00000121888
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 42 78 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126258
Predicted Effect probably benign
Transcript: ENSMUST00000130208
SMART Domains Protein: ENSMUSP00000122228
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137845
Predicted Effect probably benign
Transcript: ENSMUST00000141631
SMART Domains Protein: ENSMUSP00000118057
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000146782
AA Change: T59I

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120311
Gene: ENSMUSG00000023990
AA Change: T59I

DomainStartEndE-ValueType
HLH 99 152 1.44e-15 SMART
Pfam:DUF3371 179 332 1.1e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159641
SMART Domains Protein: ENSMUSP00000124379
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160373
SMART Domains Protein: ENSMUSP00000124708
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik AACC A 7: 40,642,479 (GRCm39) probably benign Het
A630073D07Rik A C 6: 132,604,406 (GRCm39) L13R unknown Het
Alg9 GGC GGCCGC 9: 50,686,727 (GRCm39) probably benign Het
Arb2a A T 13: 77,982,794 (GRCm39) I135L possibly damaging Het
Arc G C 15: 74,543,980 (GRCm39) T81S probably benign Het
Atad5 A T 11: 80,002,386 (GRCm39) K1059N probably damaging Het
Bdp1 C A 13: 100,196,957 (GRCm39) V1143F probably benign Het
Bdp1 C A 13: 100,196,958 (GRCm39) Q1142H probably benign Het
Ccdc33 T C 9: 57,965,574 (GRCm39) S583G probably benign Het
Cd109 TTAT TTATTTATTTATATAT 9: 78,619,813 (GRCm39) probably benign Het
Cep192 A T 18: 67,971,027 (GRCm39) R1009S probably benign Het
Clvs2 T A 10: 33,498,921 (GRCm39) H3L probably damaging Het
Cnot6 T C 11: 49,593,440 (GRCm39) M14V probably benign Het
Colec10 A G 15: 54,325,787 (GRCm39) R206G possibly damaging Het
Dennd6a T C 14: 26,350,689 (GRCm39) I598T probably damaging Het
Dmrt2 T C 19: 25,655,498 (GRCm39) S366P probably damaging Het
Dnmt1 AGTTCCTACCTCGTT AGTTCCTACCTCGTTTTGGGGGCGGAGCACCGTTCCTACCTCGTT 9: 20,821,427 (GRCm39) probably null Het
Efhb T C 17: 53,707,919 (GRCm39) D748G probably damaging Het
Etl4 C T 2: 20,524,729 (GRCm39) Q21* probably null Het
Flywch1 CCACTCCTGGTGT CCACTCCTGGTGTGGGGAGGCTACGTACTCACACACTCCTGGTGT 17: 23,981,140 (GRCm39) probably null Het
Fmn1 ACCTCC ACCTCCCCCTCC 2: 113,356,131 (GRCm39) probably benign Het
Fsip2 T A 2: 82,821,865 (GRCm39) M5866K probably benign Het
Gab3 CTT CTTATT X: 74,043,612 (GRCm39) probably null Het
Garin5a C CGGAGGGAGGAAGGCTGGATCCTGGATACCTGGGTA 7: 44,149,951 (GRCm39) probably null Het
Gnl2 T A 4: 124,937,518 (GRCm39) probably null Het
Grip2 C T 6: 91,760,574 (GRCm39) R341Q probably benign Het
Hmcn1 T A 1: 150,500,312 (GRCm39) H3960L probably damaging Het
Igkv6-25 T A 6: 70,192,762 (GRCm39) Y56* probably null Het
Il12a A T 3: 68,602,562 (GRCm39) T102S probably benign Het
Il1a T A 2: 129,144,852 (GRCm39) I189F possibly damaging Het
Inpp4b T A 8: 82,696,150 (GRCm39) Y361* probably null Het
Iqcf4 CTTTTCCTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCATTTTCCTTTTCCTTTT 9: 106,447,806 (GRCm39) probably benign Het
Irag2 AGCACATTG AGCACATTGTGCACATTG 6: 145,119,509 (GRCm39) probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Las1l AGTGG AGTGGTGG X: 94,984,422 (GRCm39) probably benign Het
Lrrc8d T C 5: 105,960,507 (GRCm39) Y306H probably damaging Het
Mamld1 AGC AGCCGC X: 70,162,426 (GRCm39) probably benign Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,136,777 (GRCm39) probably benign Het
Map1b G T 13: 99,567,258 (GRCm39) A1821E unknown Het
Maz A G 7: 126,624,669 (GRCm39) C284R probably damaging Het
Med23 A G 10: 24,779,683 (GRCm39) H920R probably damaging Het
Megf10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 18: 57,427,099 (GRCm39) probably benign Het
Mmp14 C T 14: 54,676,471 (GRCm39) R339* probably null Het
Mroh9 T G 1: 162,885,630 (GRCm39) K334T probably damaging Het
Nab1 A T 1: 52,518,441 (GRCm39) C320S probably damaging Het
Noto T C 6: 85,401,192 (GRCm39) S74P probably benign Het
Nudt4 T C 10: 95,385,236 (GRCm39) N152D possibly damaging Het
Nup155 T TTTTG 15: 8,148,660 (GRCm39) probably benign Het
Nusap1 AGCTGAGA AGCTGAGATACACGTTAGCAGTGAGGAGCAGGCTGAGA 2: 119,458,084 (GRCm39) probably benign Het
Or10al2 A C 17: 37,983,749 (GRCm39) K278N probably damaging Het
Or2d4 T A 7: 106,543,855 (GRCm39) M118L probably damaging Het
Or2t48 CA C 11: 58,419,983 (GRCm39) probably null Het
Or51f1e GTTAT GTTATTAT 7: 102,747,512 (GRCm39) Het
Or51f1e TTA TTAGTA 7: 102,747,513 (GRCm39) probably null Het
Or7g16 T C 9: 18,726,778 (GRCm39) T271A probably benign Het
Or9a7 T C 6: 40,521,296 (GRCm39) I206V probably benign Het
Plxnc1 T C 10: 94,630,306 (GRCm39) Y1531C probably damaging Het
Pnma8b TGA TGAAGA 7: 16,679,941 (GRCm39) probably benign Het
Rp1 A G 1: 4,414,917 (GRCm39) V2065A probably damaging Het
Sbp AAGATGCTGACAACA AAGATGCTGACAACAGAGATGCTGACAACA 17: 24,164,343 (GRCm39) probably benign Het
Sepsecs G A 5: 52,804,533 (GRCm39) T379M probably benign Het
Sfswap GGCC GGCCCACTCTGCC 5: 129,646,828 (GRCm39) probably benign Het
Six3 GCG GCGTCG 17: 85,928,798 (GRCm39) probably benign Het
Tgoln1 A AAACTCAG 6: 72,593,335 (GRCm39) probably null Het
Tmem94 G A 11: 115,686,958 (GRCm39) V1108M probably damaging Het
Usp35 T C 7: 96,971,303 (GRCm39) K297E possibly damaging Het
Vcpkmt T A 12: 69,629,598 (GRCm39) T55S possibly damaging Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,013,446 (GRCm39) probably benign Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,013,434 (GRCm39) probably benign Het
Zfp384 GGCCC GGCCCTGGCCCAAGCCC 6: 125,013,439 (GRCm39) probably benign Het
Zfp407 A T 18: 84,227,688 (GRCm39) S1974T probably benign Het
Zfp677 T C 17: 21,617,704 (GRCm39) S254P probably damaging Het
Other mutations in Tfeb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Tfeb APN 17 48,102,589 (GRCm39) missense probably benign 0.10
IGL03248:Tfeb APN 17 48,097,920 (GRCm39) missense probably benign
IGL03280:Tfeb APN 17 48,096,862 (GRCm39) missense probably benign
FR4304:Tfeb UTSW 17 48,097,019 (GRCm39) small insertion probably benign
FR4976:Tfeb UTSW 17 48,097,019 (GRCm39) small insertion probably benign
R0414:Tfeb UTSW 17 48,099,224 (GRCm39) splice site probably null
R1712:Tfeb UTSW 17 48,099,911 (GRCm39) critical splice donor site probably null
R2014:Tfeb UTSW 17 48,102,484 (GRCm39) missense probably damaging 0.97
R2101:Tfeb UTSW 17 48,100,590 (GRCm39) missense probably damaging 1.00
R4283:Tfeb UTSW 17 48,100,699 (GRCm39) missense probably damaging 1.00
R4734:Tfeb UTSW 17 48,096,787 (GRCm39) missense probably benign 0.33
R4785:Tfeb UTSW 17 48,099,152 (GRCm39) splice site probably null
R4948:Tfeb UTSW 17 48,096,904 (GRCm39) missense probably benign 0.00
R5896:Tfeb UTSW 17 48,070,433 (GRCm39) critical splice donor site probably null
R6522:Tfeb UTSW 17 48,100,627 (GRCm39) missense probably damaging 1.00
R6804:Tfeb UTSW 17 48,100,735 (GRCm39) critical splice donor site probably null
R6836:Tfeb UTSW 17 48,097,123 (GRCm39) critical splice donor site probably null
R6923:Tfeb UTSW 17 48,097,908 (GRCm39) missense probably benign 0.11
RF002:Tfeb UTSW 17 48,097,027 (GRCm39) small insertion probably benign
RF006:Tfeb UTSW 17 48,097,038 (GRCm39) small insertion probably benign
RF008:Tfeb UTSW 17 48,097,027 (GRCm39) small insertion probably benign
RF010:Tfeb UTSW 17 48,097,032 (GRCm39) small insertion probably benign
RF010:Tfeb UTSW 17 48,097,019 (GRCm39) small insertion probably benign
RF018:Tfeb UTSW 17 48,097,020 (GRCm39) small insertion probably benign
RF022:Tfeb UTSW 17 48,097,019 (GRCm39) small insertion probably benign
RF025:Tfeb UTSW 17 48,097,013 (GRCm39) small insertion probably benign
RF028:Tfeb UTSW 17 48,097,022 (GRCm39) small insertion probably benign
RF030:Tfeb UTSW 17 48,097,036 (GRCm39) small insertion probably benign
RF030:Tfeb UTSW 17 48,097,037 (GRCm39) small insertion probably benign
RF030:Tfeb UTSW 17 48,097,038 (GRCm39) small insertion probably benign
RF034:Tfeb UTSW 17 48,097,023 (GRCm39) nonsense probably null
RF034:Tfeb UTSW 17 48,097,022 (GRCm39) small insertion probably benign
RF035:Tfeb UTSW 17 48,097,036 (GRCm39) small insertion probably benign
RF036:Tfeb UTSW 17 48,097,028 (GRCm39) small insertion probably benign
RF038:Tfeb UTSW 17 48,097,037 (GRCm39) small insertion probably benign
RF038:Tfeb UTSW 17 48,097,030 (GRCm39) small insertion probably benign
RF039:Tfeb UTSW 17 48,097,035 (GRCm39) nonsense probably null
RF039:Tfeb UTSW 17 48,097,020 (GRCm39) small insertion probably benign
RF040:Tfeb UTSW 17 48,097,036 (GRCm39) small insertion probably benign
RF040:Tfeb UTSW 17 48,097,035 (GRCm39) small insertion probably benign
RF040:Tfeb UTSW 17 48,097,022 (GRCm39) small insertion probably benign
RF040:Tfeb UTSW 17 48,097,037 (GRCm39) small insertion probably benign
RF041:Tfeb UTSW 17 48,097,025 (GRCm39) small insertion probably benign
RF042:Tfeb UTSW 17 48,097,022 (GRCm39) small insertion probably benign
RF047:Tfeb UTSW 17 48,097,041 (GRCm39) small insertion probably benign
RF047:Tfeb UTSW 17 48,097,031 (GRCm39) small insertion probably benign
RF053:Tfeb UTSW 17 48,097,039 (GRCm39) small insertion probably benign
RF054:Tfeb UTSW 17 48,097,023 (GRCm39) nonsense probably null
RF060:Tfeb UTSW 17 48,097,031 (GRCm39) small insertion probably benign
RF061:Tfeb UTSW 17 48,097,017 (GRCm39) small insertion probably benign
RF062:Tfeb UTSW 17 48,097,025 (GRCm39) small insertion probably benign
Z1177:Tfeb UTSW 17 48,102,569 (GRCm39) missense possibly damaging 0.74
Z1177:Tfeb UTSW 17 48,097,449 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACATTGCATCCTGGGGAAG -3'
(R):5'- CAGCACCACTCACTTAGGTTG -3'

Sequencing Primer
(F):5'- GGGGCTCAGGGGTGACTTTC -3'
(R):5'- GCACCACTCACTTAGGTTGTGATTG -3'
Posted On 2019-12-04