Incidental Mutation 'RF003:Tfeb'
ID 602663
Institutional Source Beutler Lab
Gene Symbol Tfeb
Ensembl Gene ENSMUSG00000023990
Gene Name transcription factor EB
Synonyms bHLHe35, TFEB, Tcfeb
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # RF003 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 47737030-47792419 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 47788078 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 259 (T259I)
Ref Sequence ENSEMBL: ENSMUSP00000024786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024786] [ENSMUST00000086932] [ENSMUST00000113284] [ENSMUST00000113288] [ENSMUST00000125177] [ENSMUST00000126258] [ENSMUST00000130208] [ENSMUST00000137845] [ENSMUST00000141631] [ENSMUST00000146782] [ENSMUST00000159641] [ENSMUST00000160373]
AlphaFold Q9R210
Predicted Effect possibly damaging
Transcript: ENSMUST00000024786
AA Change: T259I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000024786
Gene: ENSMUSG00000023990
AA Change: T259I

Pfam:MITF_TFEB_C_3_N 63 220 2e-69 PFAM
HLH 299 352 1.44e-15 SMART
Pfam:DUF3371 379 531 1.8e-39 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000086932
AA Change: T200I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000084151
Gene: ENSMUSG00000023990
AA Change: T200I

low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
HLH 240 293 1.44e-15 SMART
Pfam:DUF3371 320 473 7e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113284
AA Change: T200I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108909
Gene: ENSMUSG00000023990
AA Change: T200I

low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
Pfam:HLH 235 266 1.4e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113288
AA Change: T200I

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108913
Gene: ENSMUSG00000023990
AA Change: T200I

low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
HLH 240 293 1.44e-15 SMART
Pfam:DUF3371 320 473 7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125177
SMART Domains Protein: ENSMUSP00000121888
Gene: ENSMUSG00000023990

signal peptide 1 20 N/A INTRINSIC
low complexity region 42 78 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126258
Predicted Effect probably benign
Transcript: ENSMUST00000130208
SMART Domains Protein: ENSMUSP00000122228
Gene: ENSMUSG00000023990

low complexity region 7 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137845
Predicted Effect probably benign
Transcript: ENSMUST00000141631
SMART Domains Protein: ENSMUSP00000118057
Gene: ENSMUSG00000023990

low complexity region 7 43 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000146782
AA Change: T59I

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120311
Gene: ENSMUSG00000023990
AA Change: T59I

HLH 99 152 1.44e-15 SMART
Pfam:DUF3371 179 332 1.1e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159641
SMART Domains Protein: ENSMUSP00000124379
Gene: ENSMUSG00000023990

low complexity region 7 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160373
SMART Domains Protein: ENSMUSP00000124708
Gene: ENSMUSG00000023990

low complexity region 7 43 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik AACC A 7: 40,993,055 probably benign Het
A630073D07Rik A C 6: 132,627,443 L13R unknown Het
Alg9 GGC GGCCGC 9: 50,775,427 probably benign Het
Arc G C 15: 74,672,131 T81S probably benign Het
Atad5 A T 11: 80,111,560 K1059N probably damaging Het
Bdp1 C A 13: 100,060,449 V1143F probably benign Het
Bdp1 C A 13: 100,060,450 Q1142H probably benign Het
Ccdc33 T C 9: 58,058,291 S583G probably benign Het
Cd109 TTAT TTATTTATTTATATAT 9: 78,712,531 probably benign Het
Cep192 A T 18: 67,837,956 R1009S probably benign Het
Clvs2 T A 10: 33,622,925 H3L probably damaging Het
Cnot6 T C 11: 49,702,613 M14V probably benign Het
Colec10 A G 15: 54,462,391 R206G possibly damaging Het
Dennd6a T C 14: 26,629,534 I598T probably damaging Het
Dmrt2 T C 19: 25,678,134 S366P probably damaging Het
Efhb T C 17: 53,400,891 D748G probably damaging Het
Etl4 C T 2: 20,519,918 Q21* probably null Het
Fam172a A T 13: 77,834,675 I135L possibly damaging Het
Fam71e1 C CGGAGGGAGGAAGGCTGGATCCTGGATACCTGGGTA 7: 44,500,527 probably null Het
Fmn1 ACCTCC ACCTCCCCCTCC 2: 113,525,786 probably benign Het
Fsip2 T A 2: 82,991,521 M5866K probably benign Het
Gab3 CTT CTTATT X: 75,000,006 probably null Het
Gnl2 T A 4: 125,043,725 probably null Het
Grip2 C T 6: 91,783,593 R341Q probably benign Het
Hmcn1 T A 1: 150,624,561 H3960L probably damaging Het
Igkv6-25 T A 6: 70,215,778 Y56* probably null Het
Il12a A T 3: 68,695,229 T102S probably benign Het
Il1a T A 2: 129,302,932 I189F possibly damaging Het
Inpp4b T A 8: 81,969,521 Y361* probably null Het
Las1l AGTGG AGTGGTGG X: 95,940,816 probably benign Het
Lrmp AGCACATTG AGCACATTGTGCACATTG 6: 145,173,783 probably benign Het
Lrrc8d T C 5: 105,812,641 Y306H probably damaging Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Map1b G T 13: 99,430,750 A1821E unknown Het
Maz A G 7: 127,025,497 C284R probably damaging Het
Med23 A G 10: 24,903,785 H920R probably damaging Het
Mmp14 C T 14: 54,439,014 R339* probably null Het
Mroh9 T G 1: 163,058,061 K334T probably damaging Het
Nab1 A T 1: 52,479,282 C320S probably damaging Het
Noto T C 6: 85,424,210 S74P probably benign Het
Nudt4 T C 10: 95,549,374 N152D possibly damaging Het
Nup155 T TTTTG 15: 8,119,176 probably benign Het
Olfr118 A C 17: 37,672,858 K278N probably damaging Het
Olfr330 CA C 11: 58,529,157 probably null Het
Olfr461 T C 6: 40,544,362 I206V probably benign Het
Olfr585 GTTAT GTTATTAT 7: 103,098,305 Het
Olfr585 TTA TTAGTA 7: 103,098,306 probably null Het
Olfr710 T A 7: 106,944,648 M118L probably damaging Het
Olfr828 T C 9: 18,815,482 T271A probably benign Het
Plxnc1 T C 10: 94,794,444 Y1531C probably damaging Het
Pnmal2 TGA TGAAGA 7: 16,946,016 probably benign Het
Rp1 A G 1: 4,344,694 V2065A probably damaging Het
Sepsecs G A 5: 52,647,191 T379M probably benign Het
Sfswap GGCC GGCCCACTCTGCC 5: 129,569,764 probably benign Het
Six3 GCG GCGTCG 17: 85,621,370 probably benign Het
Tgoln1 A AAACTCAG 6: 72,616,352 probably null Het
Tmem94 G A 11: 115,796,132 V1108M probably damaging Het
Usp35 T C 7: 97,322,096 K297E possibly damaging Het
Vcpkmt T A 12: 69,582,824 T55S possibly damaging Het
Zfp384 GGCCC GGCCCTGGCCCAAGCCC 6: 125,036,476 probably benign Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,036,483 probably benign Het
Zfp407 A T 18: 84,209,563 S1974T probably benign Het
Zfp677 T C 17: 21,397,442 S254P probably damaging Het
Other mutations in Tfeb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Tfeb APN 17 47791664 missense probably benign 0.10
IGL03248:Tfeb APN 17 47786995 missense probably benign
IGL03280:Tfeb APN 17 47785937 missense probably benign
FR4304:Tfeb UTSW 17 47786094 small insertion probably benign
FR4976:Tfeb UTSW 17 47786094 small insertion probably benign
R0414:Tfeb UTSW 17 47788299 splice site probably null
R1712:Tfeb UTSW 17 47788986 critical splice donor site probably null
R2014:Tfeb UTSW 17 47791559 missense probably damaging 0.97
R2101:Tfeb UTSW 17 47789665 missense probably damaging 1.00
R4283:Tfeb UTSW 17 47789774 missense probably damaging 1.00
R4734:Tfeb UTSW 17 47785862 missense probably benign 0.33
R4785:Tfeb UTSW 17 47788227 splice site probably null
R4948:Tfeb UTSW 17 47785979 missense probably benign 0.00
R5896:Tfeb UTSW 17 47759508 critical splice donor site probably null
R6522:Tfeb UTSW 17 47789702 missense probably damaging 1.00
R6804:Tfeb UTSW 17 47789810 critical splice donor site probably null
R6836:Tfeb UTSW 17 47786198 critical splice donor site probably null
R6923:Tfeb UTSW 17 47786983 missense probably benign 0.11
RF002:Tfeb UTSW 17 47786102 small insertion probably benign
RF006:Tfeb UTSW 17 47786113 small insertion probably benign
RF008:Tfeb UTSW 17 47786102 small insertion probably benign
RF010:Tfeb UTSW 17 47786094 small insertion probably benign
RF010:Tfeb UTSW 17 47786107 small insertion probably benign
RF018:Tfeb UTSW 17 47786095 small insertion probably benign
RF022:Tfeb UTSW 17 47786094 small insertion probably benign
RF025:Tfeb UTSW 17 47786088 small insertion probably benign
RF028:Tfeb UTSW 17 47786097 small insertion probably benign
RF030:Tfeb UTSW 17 47786111 small insertion probably benign
RF030:Tfeb UTSW 17 47786112 small insertion probably benign
RF030:Tfeb UTSW 17 47786113 small insertion probably benign
RF034:Tfeb UTSW 17 47786097 small insertion probably benign
RF034:Tfeb UTSW 17 47786098 nonsense probably null
RF035:Tfeb UTSW 17 47786111 small insertion probably benign
RF036:Tfeb UTSW 17 47786103 small insertion probably benign
RF038:Tfeb UTSW 17 47786105 small insertion probably benign
RF038:Tfeb UTSW 17 47786112 small insertion probably benign
RF039:Tfeb UTSW 17 47786095 small insertion probably benign
RF039:Tfeb UTSW 17 47786110 nonsense probably null
RF040:Tfeb UTSW 17 47786097 small insertion probably benign
RF040:Tfeb UTSW 17 47786110 small insertion probably benign
RF040:Tfeb UTSW 17 47786111 small insertion probably benign
RF040:Tfeb UTSW 17 47786112 small insertion probably benign
RF041:Tfeb UTSW 17 47786100 small insertion probably benign
RF042:Tfeb UTSW 17 47786097 small insertion probably benign
RF047:Tfeb UTSW 17 47786106 small insertion probably benign
RF047:Tfeb UTSW 17 47786116 small insertion probably benign
RF053:Tfeb UTSW 17 47786114 small insertion probably benign
RF054:Tfeb UTSW 17 47786098 nonsense probably null
RF060:Tfeb UTSW 17 47786106 small insertion probably benign
RF061:Tfeb UTSW 17 47786092 small insertion probably benign
RF062:Tfeb UTSW 17 47786100 small insertion probably benign
Z1177:Tfeb UTSW 17 47786524 nonsense probably null
Z1177:Tfeb UTSW 17 47791644 missense possibly damaging 0.74
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04