Incidental Mutation 'RF003:Zfp407'
ID 602668
Institutional Source Beutler Lab
Gene Symbol Zfp407
Ensembl Gene ENSMUSG00000048410
Gene Name zinc finger protein 407
Synonyms LOC381139, 6430585N13Rik, LOC240469
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF003 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 84225826-84612815 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 84227688 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1974 (S1974T)
Ref Sequence ENSEMBL: ENSMUSP00000118361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000125763]
AlphaFold G3UVV3
Predicted Effect probably benign
Transcript: ENSMUST00000125450
Predicted Effect probably benign
Transcript: ENSMUST00000125763
AA Change: S1974T

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000118361
Gene: ENSMUSG00000048410
AA Change: S1974T

DomainStartEndE-ValueType
low complexity region 20 37 N/A INTRINSIC
ZnF_C2H2 178 200 8.67e-1 SMART
ZnF_U1 233 267 6.79e-1 SMART
ZnF_C2H2 236 260 4.65e-1 SMART
ZnF_C2H2 522 545 7.05e-1 SMART
ZnF_U1 548 582 1.54e1 SMART
ZnF_C2H2 551 575 1.01e-1 SMART
ZnF_C2H2 582 605 1.41e0 SMART
ZnF_U1 606 639 2.22e0 SMART
ZnF_C2H2 609 632 1.01e2 SMART
ZnF_C2H2 695 718 6.23e-2 SMART
ZnF_U1 721 755 2.96e0 SMART
ZnF_C2H2 724 748 7.11e0 SMART
ZnF_C2H2 840 863 7.55e-1 SMART
ZnF_U1 866 900 3.81e-1 SMART
ZnF_C2H2 869 893 1.07e0 SMART
ZnF_C2H2 1009 1032 6.13e-1 SMART
ZnF_U1 1035 1069 2.22e0 SMART
ZnF_C2H2 1038 1062 5.62e0 SMART
low complexity region 1223 1234 N/A INTRINSIC
ZnF_C2H2 1405 1428 5.92e0 SMART
ZnF_U1 1432 1466 2.35e0 SMART
ZnF_C2H2 1435 1459 1.76e-1 SMART
ZnF_C2H2 1477 1500 5.42e-2 SMART
ZnF_C2H2 1528 1552 1.68e1 SMART
ZnF_C2H2 1558 1580 1.43e-1 SMART
ZnF_C2H2 1586 1609 9.58e-3 SMART
ZnF_C2H2 1619 1641 2.61e-4 SMART
ZnF_C2H2 1647 1671 1.04e-3 SMART
ZnF_C2H2 1677 1699 9.44e-2 SMART
ZnF_C2H2 1705 1727 1.82e-3 SMART
ZnF_C2H2 1733 1758 4.65e-1 SMART
ZnF_C2H2 1764 1787 1.26e-2 SMART
low complexity region 1876 1887 N/A INTRINSIC
low complexity region 2017 2032 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein whose exact function is not known. It may be involved in transcriptional regulation. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik AACC A 7: 40,642,479 (GRCm39) probably benign Het
A630073D07Rik A C 6: 132,604,406 (GRCm39) L13R unknown Het
Alg9 GGC GGCCGC 9: 50,686,727 (GRCm39) probably benign Het
Arb2a A T 13: 77,982,794 (GRCm39) I135L possibly damaging Het
Arc G C 15: 74,543,980 (GRCm39) T81S probably benign Het
Atad5 A T 11: 80,002,386 (GRCm39) K1059N probably damaging Het
Bdp1 C A 13: 100,196,957 (GRCm39) V1143F probably benign Het
Bdp1 C A 13: 100,196,958 (GRCm39) Q1142H probably benign Het
Ccdc33 T C 9: 57,965,574 (GRCm39) S583G probably benign Het
Cd109 TTAT TTATTTATTTATATAT 9: 78,619,813 (GRCm39) probably benign Het
Cep192 A T 18: 67,971,027 (GRCm39) R1009S probably benign Het
Clvs2 T A 10: 33,498,921 (GRCm39) H3L probably damaging Het
Cnot6 T C 11: 49,593,440 (GRCm39) M14V probably benign Het
Colec10 A G 15: 54,325,787 (GRCm39) R206G possibly damaging Het
Dennd6a T C 14: 26,350,689 (GRCm39) I598T probably damaging Het
Dmrt2 T C 19: 25,655,498 (GRCm39) S366P probably damaging Het
Dnmt1 AGTTCCTACCTCGTT AGTTCCTACCTCGTTTTGGGGGCGGAGCACCGTTCCTACCTCGTT 9: 20,821,427 (GRCm39) probably null Het
Efhb T C 17: 53,707,919 (GRCm39) D748G probably damaging Het
Etl4 C T 2: 20,524,729 (GRCm39) Q21* probably null Het
Flywch1 CCACTCCTGGTGT CCACTCCTGGTGTGGGGAGGCTACGTACTCACACACTCCTGGTGT 17: 23,981,140 (GRCm39) probably null Het
Fmn1 ACCTCC ACCTCCCCCTCC 2: 113,356,131 (GRCm39) probably benign Het
Fsip2 T A 2: 82,821,865 (GRCm39) M5866K probably benign Het
Gab3 CTT CTTATT X: 74,043,612 (GRCm39) probably null Het
Garin5a C CGGAGGGAGGAAGGCTGGATCCTGGATACCTGGGTA 7: 44,149,951 (GRCm39) probably null Het
Gnl2 T A 4: 124,937,518 (GRCm39) probably null Het
Grip2 C T 6: 91,760,574 (GRCm39) R341Q probably benign Het
Hmcn1 T A 1: 150,500,312 (GRCm39) H3960L probably damaging Het
Igkv6-25 T A 6: 70,192,762 (GRCm39) Y56* probably null Het
Il12a A T 3: 68,602,562 (GRCm39) T102S probably benign Het
Il1a T A 2: 129,144,852 (GRCm39) I189F possibly damaging Het
Inpp4b T A 8: 82,696,150 (GRCm39) Y361* probably null Het
Iqcf4 CTTTTCCTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCATTTTCCTTTTCCTTTT 9: 106,447,806 (GRCm39) probably benign Het
Irag2 AGCACATTG AGCACATTGTGCACATTG 6: 145,119,509 (GRCm39) probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Las1l AGTGG AGTGGTGG X: 94,984,422 (GRCm39) probably benign Het
Lrrc8d T C 5: 105,960,507 (GRCm39) Y306H probably damaging Het
Mamld1 AGC AGCCGC X: 70,162,426 (GRCm39) probably benign Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,136,777 (GRCm39) probably benign Het
Map1b G T 13: 99,567,258 (GRCm39) A1821E unknown Het
Maz A G 7: 126,624,669 (GRCm39) C284R probably damaging Het
Med23 A G 10: 24,779,683 (GRCm39) H920R probably damaging Het
Megf10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 18: 57,427,099 (GRCm39) probably benign Het
Mmp14 C T 14: 54,676,471 (GRCm39) R339* probably null Het
Mroh9 T G 1: 162,885,630 (GRCm39) K334T probably damaging Het
Nab1 A T 1: 52,518,441 (GRCm39) C320S probably damaging Het
Noto T C 6: 85,401,192 (GRCm39) S74P probably benign Het
Nudt4 T C 10: 95,385,236 (GRCm39) N152D possibly damaging Het
Nup155 T TTTTG 15: 8,148,660 (GRCm39) probably benign Het
Nusap1 AGCTGAGA AGCTGAGATACACGTTAGCAGTGAGGAGCAGGCTGAGA 2: 119,458,084 (GRCm39) probably benign Het
Or10al2 A C 17: 37,983,749 (GRCm39) K278N probably damaging Het
Or2d4 T A 7: 106,543,855 (GRCm39) M118L probably damaging Het
Or2t48 CA C 11: 58,419,983 (GRCm39) probably null Het
Or51f1e TTA TTAGTA 7: 102,747,513 (GRCm39) probably null Het
Or51f1e GTTAT GTTATTAT 7: 102,747,512 (GRCm39) Het
Or7g16 T C 9: 18,726,778 (GRCm39) T271A probably benign Het
Or9a7 T C 6: 40,521,296 (GRCm39) I206V probably benign Het
Plxnc1 T C 10: 94,630,306 (GRCm39) Y1531C probably damaging Het
Pnma8b TGA TGAAGA 7: 16,679,941 (GRCm39) probably benign Het
Rp1 A G 1: 4,414,917 (GRCm39) V2065A probably damaging Het
Sbp AAGATGCTGACAACA AAGATGCTGACAACAGAGATGCTGACAACA 17: 24,164,343 (GRCm39) probably benign Het
Sepsecs G A 5: 52,804,533 (GRCm39) T379M probably benign Het
Sfswap GGCC GGCCCACTCTGCC 5: 129,646,828 (GRCm39) probably benign Het
Six3 GCG GCGTCG 17: 85,928,798 (GRCm39) probably benign Het
Tfeb C T 17: 48,099,003 (GRCm39) T259I possibly damaging Het
Tgoln1 A AAACTCAG 6: 72,593,335 (GRCm39) probably null Het
Tmem94 G A 11: 115,686,958 (GRCm39) V1108M probably damaging Het
Usp35 T C 7: 96,971,303 (GRCm39) K297E possibly damaging Het
Vcpkmt T A 12: 69,629,598 (GRCm39) T55S possibly damaging Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,013,446 (GRCm39) probably benign Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,013,434 (GRCm39) probably benign Het
Zfp384 GGCCC GGCCCTGGCCCAAGCCC 6: 125,013,439 (GRCm39) probably benign Het
Zfp677 T C 17: 21,617,704 (GRCm39) S254P probably damaging Het
Other mutations in Zfp407
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Zfp407 APN 18 84,579,877 (GRCm39) missense probably damaging 0.99
IGL02105:Zfp407 APN 18 84,580,845 (GRCm39) nonsense probably null
IGL02110:Zfp407 APN 18 84,577,165 (GRCm39) missense probably benign 0.00
IGL02343:Zfp407 APN 18 84,227,849 (GRCm39) missense possibly damaging 0.71
IGL02456:Zfp407 APN 18 84,576,766 (GRCm39) missense probably damaging 1.00
IGL02705:Zfp407 APN 18 84,577,156 (GRCm39) nonsense probably null
IGL02946:Zfp407 APN 18 84,578,834 (GRCm39) missense probably damaging 1.00
IGL03069:Zfp407 APN 18 84,369,100 (GRCm39) missense probably damaging 1.00
IGL03145:Zfp407 APN 18 84,227,846 (GRCm39) missense probably damaging 0.99
IGL03403:Zfp407 APN 18 84,578,922 (GRCm39) missense probably damaging 1.00
IGL03134:Zfp407 UTSW 18 84,228,080 (GRCm39) missense probably damaging 0.99
PIT4362001:Zfp407 UTSW 18 84,579,393 (GRCm39) missense possibly damaging 0.87
PIT4520001:Zfp407 UTSW 18 84,450,545 (GRCm39) missense probably damaging 0.99
R0087:Zfp407 UTSW 18 84,578,536 (GRCm39) missense probably damaging 1.00
R0243:Zfp407 UTSW 18 84,576,836 (GRCm39) missense probably damaging 1.00
R0594:Zfp407 UTSW 18 84,580,692 (GRCm39) missense possibly damaging 0.87
R0766:Zfp407 UTSW 18 84,577,898 (GRCm39) missense probably benign 0.14
R0787:Zfp407 UTSW 18 84,227,471 (GRCm39) missense probably benign 0.00
R0787:Zfp407 UTSW 18 84,227,147 (GRCm39) missense probably damaging 1.00
R1065:Zfp407 UTSW 18 84,577,898 (GRCm39) missense probably benign 0.14
R1086:Zfp407 UTSW 18 84,577,898 (GRCm39) missense probably benign 0.14
R1165:Zfp407 UTSW 18 84,577,898 (GRCm39) missense probably benign 0.14
R1186:Zfp407 UTSW 18 84,227,573 (GRCm39) missense probably benign 0.39
R1203:Zfp407 UTSW 18 84,577,898 (GRCm39) missense probably benign 0.14
R1312:Zfp407 UTSW 18 84,577,898 (GRCm39) missense probably benign 0.14
R1345:Zfp407 UTSW 18 84,577,898 (GRCm39) missense probably benign 0.14
R1385:Zfp407 UTSW 18 84,577,898 (GRCm39) missense probably benign 0.14
R1421:Zfp407 UTSW 18 84,577,898 (GRCm39) missense probably benign 0.14
R1430:Zfp407 UTSW 18 84,227,580 (GRCm39) missense probably benign 0.18
R1436:Zfp407 UTSW 18 84,361,196 (GRCm39) splice site probably benign
R1498:Zfp407 UTSW 18 84,577,898 (GRCm39) missense probably benign 0.14
R1526:Zfp407 UTSW 18 84,579,158 (GRCm39) missense possibly damaging 0.61
R1579:Zfp407 UTSW 18 84,227,763 (GRCm39) missense probably benign 0.00
R1594:Zfp407 UTSW 18 84,227,456 (GRCm39) missense probably benign 0.01
R1628:Zfp407 UTSW 18 84,372,658 (GRCm39) missense probably damaging 1.00
R1698:Zfp407 UTSW 18 84,580,282 (GRCm39) missense probably damaging 1.00
R1962:Zfp407 UTSW 18 84,577,461 (GRCm39) missense probably benign 0.01
R1984:Zfp407 UTSW 18 84,577,898 (GRCm39) missense probably benign 0.14
R1985:Zfp407 UTSW 18 84,577,898 (GRCm39) missense probably benign 0.14
R1986:Zfp407 UTSW 18 84,577,898 (GRCm39) missense probably benign 0.14
R2151:Zfp407 UTSW 18 84,227,774 (GRCm39) missense possibly damaging 0.55
R2152:Zfp407 UTSW 18 84,227,774 (GRCm39) missense possibly damaging 0.55
R2154:Zfp407 UTSW 18 84,227,774 (GRCm39) missense possibly damaging 0.55
R2259:Zfp407 UTSW 18 84,227,918 (GRCm39) missense probably damaging 1.00
R2353:Zfp407 UTSW 18 84,578,005 (GRCm39) missense probably damaging 1.00
R2845:Zfp407 UTSW 18 84,576,522 (GRCm39) nonsense probably null
R3407:Zfp407 UTSW 18 84,576,997 (GRCm39) missense probably benign 0.08
R3432:Zfp407 UTSW 18 84,226,871 (GRCm39) missense probably damaging 1.00
R3892:Zfp407 UTSW 18 84,578,477 (GRCm39) missense probably damaging 1.00
R4026:Zfp407 UTSW 18 84,577,721 (GRCm39) missense possibly damaging 0.82
R4107:Zfp407 UTSW 18 84,361,132 (GRCm39) missense possibly damaging 0.82
R4398:Zfp407 UTSW 18 84,580,856 (GRCm39) nonsense probably null
R4447:Zfp407 UTSW 18 84,580,819 (GRCm39) missense possibly damaging 0.95
R4752:Zfp407 UTSW 18 84,581,039 (GRCm39) missense probably benign 0.01
R4881:Zfp407 UTSW 18 84,577,828 (GRCm39) missense probably benign 0.27
R4936:Zfp407 UTSW 18 84,577,589 (GRCm39) missense probably benign 0.00
R5194:Zfp407 UTSW 18 84,579,434 (GRCm39) missense probably benign 0.05
R5243:Zfp407 UTSW 18 84,579,216 (GRCm39) missense probably damaging 1.00
R5258:Zfp407 UTSW 18 84,334,051 (GRCm39) missense probably damaging 1.00
R5591:Zfp407 UTSW 18 84,579,262 (GRCm39) missense probably damaging 1.00
R5633:Zfp407 UTSW 18 84,579,169 (GRCm39) missense probably benign 0.35
R5739:Zfp407 UTSW 18 84,226,867 (GRCm39) makesense probably null
R5806:Zfp407 UTSW 18 84,576,739 (GRCm39) missense probably damaging 1.00
R5820:Zfp407 UTSW 18 84,578,649 (GRCm39) missense probably benign 0.01
R6187:Zfp407 UTSW 18 84,577,134 (GRCm39) missense possibly damaging 0.87
R6512:Zfp407 UTSW 18 84,578,474 (GRCm39) missense probably damaging 1.00
R6521:Zfp407 UTSW 18 84,450,536 (GRCm39) missense probably damaging 1.00
R6748:Zfp407 UTSW 18 84,226,955 (GRCm39) missense probably damaging 0.98
R6882:Zfp407 UTSW 18 84,361,194 (GRCm39) splice site probably null
R6899:Zfp407 UTSW 18 84,579,559 (GRCm39) missense possibly damaging 0.86
R7038:Zfp407 UTSW 18 84,579,982 (GRCm39) missense probably damaging 1.00
R7076:Zfp407 UTSW 18 84,576,601 (GRCm39) missense probably damaging 1.00
R7326:Zfp407 UTSW 18 84,577,167 (GRCm39) missense possibly damaging 0.77
R7397:Zfp407 UTSW 18 84,579,944 (GRCm39) missense possibly damaging 0.59
R7402:Zfp407 UTSW 18 84,579,661 (GRCm39) missense probably benign 0.02
R7783:Zfp407 UTSW 18 84,228,047 (GRCm39) missense possibly damaging 0.69
R7800:Zfp407 UTSW 18 84,578,800 (GRCm39) missense probably damaging 0.99
R7904:Zfp407 UTSW 18 84,579,381 (GRCm39) missense not run
R7942:Zfp407 UTSW 18 84,577,754 (GRCm39) missense probably benign 0.02
R7955:Zfp407 UTSW 18 84,577,416 (GRCm39) missense probably benign 0.02
R7988:Zfp407 UTSW 18 84,577,525 (GRCm39) missense possibly damaging 0.60
R8125:Zfp407 UTSW 18 84,579,310 (GRCm39) missense probably damaging 1.00
R8237:Zfp407 UTSW 18 84,578,269 (GRCm39) missense possibly damaging 0.87
R8364:Zfp407 UTSW 18 84,570,993 (GRCm39) critical splice donor site probably null
R8443:Zfp407 UTSW 18 84,227,987 (GRCm39) missense probably damaging 1.00
R8487:Zfp407 UTSW 18 84,580,895 (GRCm39) nonsense probably null
R8497:Zfp407 UTSW 18 84,578,021 (GRCm39) missense probably damaging 0.98
R8808:Zfp407 UTSW 18 84,361,185 (GRCm39) missense probably benign 0.17
R8848:Zfp407 UTSW 18 84,578,819 (GRCm39) missense probably damaging 1.00
R8913:Zfp407 UTSW 18 84,578,653 (GRCm39) missense probably damaging 0.99
R8962:Zfp407 UTSW 18 84,577,057 (GRCm39) missense probably damaging 1.00
R9087:Zfp407 UTSW 18 84,227,982 (GRCm39) missense probably damaging 0.96
R9452:Zfp407 UTSW 18 84,580,579 (GRCm39) missense probably benign 0.02
R9691:Zfp407 UTSW 18 84,578,312 (GRCm39) missense probably benign 0.03
R9766:Zfp407 UTSW 18 84,577,574 (GRCm39) missense probably benign 0.06
Z1177:Zfp407 UTSW 18 84,228,079 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCTTGGAACAGCTGAGCCTC -3'
(R):5'- ATTGCCACAAGTCAGAACGG -3'

Sequencing Primer
(F):5'- AACAGCTGAGCCTCCGTGG -3'
(R):5'- TCAGAACGGGTCGCATGTG -3'
Posted On 2019-12-04