Incidental Mutation 'RF003:Gab3'
ID602671
Institutional Source Beutler Lab
Gene Symbol Gab3
Ensembl Gene ENSMUSG00000032750
Gene Namegrowth factor receptor bound protein 2-associated protein 3
Synonyms5930433H21Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF003 (G1)
Quality Score125.467
Status Not validated
ChromosomeX
Chromosomal Location74966843-75085458 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) CTT to CTTATT at 75000006 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037374] [ENSMUST00000114104] [ENSMUST00000114109]
Predicted Effect probably null
Transcript: ENSMUST00000037374
SMART Domains Protein: ENSMUSP00000041951
Gene: ENSMUSG00000032750

DomainStartEndE-ValueType
PH 6 119 3.2e-21 SMART
low complexity region 269 280 N/A INTRINSIC
low complexity region 307 314 N/A INTRINSIC
low complexity region 424 435 N/A INTRINSIC
coiled coil region 494 520 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114104
SMART Domains Protein: ENSMUSP00000109739
Gene: ENSMUSG00000032750

DomainStartEndE-ValueType
PH 6 119 3.2e-21 SMART
low complexity region 269 280 N/A INTRINSIC
low complexity region 307 314 N/A INTRINSIC
low complexity region 424 435 N/A INTRINSIC
coiled coil region 495 527 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114109
SMART Domains Protein: ENSMUSP00000109744
Gene: ENSMUSG00000032750

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
coiled coil region 97 123 N/A INTRINSIC
Pfam:Pcc1 170 228 1.1e-9 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the GRB2-associated binding protein gene family. These proteins are scaffolding/docking proteins that are involved in several growth factor and cytokine signaling pathways, and they contain a pleckstrin homology domain, and bind SHP2 tyrosine phosphatase and GRB2 adapter protein. The protein encoded by this gene facilitates macrophage differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Females homozygous and males hemizygous for disruptions in this X-linked gene developed normally, exhibted normal hematopoiesis, and were immunocompetent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik AACC A 7: 40,993,055 probably benign Het
A630073D07Rik A C 6: 132,627,443 L13R unknown Het
Alg9 GGC GGCCGC 9: 50,775,427 probably benign Het
Arc G C 15: 74,672,131 T81S probably benign Het
Atad5 A T 11: 80,111,560 K1059N probably damaging Het
Bdp1 C A 13: 100,060,449 V1143F probably benign Het
Bdp1 C A 13: 100,060,450 Q1142H probably benign Het
Ccdc33 T C 9: 58,058,291 S583G probably benign Het
Cd109 TTAT TTATTTATTTATATAT 9: 78,712,531 probably benign Het
Cep192 A T 18: 67,837,956 R1009S probably benign Het
Clvs2 T A 10: 33,622,925 H3L probably damaging Het
Cnot6 T C 11: 49,702,613 M14V probably benign Het
Colec10 A G 15: 54,462,391 R206G possibly damaging Het
Dennd6a T C 14: 26,629,534 I598T probably damaging Het
Dmrt2 T C 19: 25,678,134 S366P probably damaging Het
Dnmt1 AGTTCCTACCTCGTT AGTTCCTACCTCGTTTTGGGGGCGGAGCACCGTTCCTACCTCGTT 9: 20,910,131 probably null Het
Efhb T C 17: 53,400,891 D748G probably damaging Het
Etl4 C T 2: 20,519,918 Q21* probably null Het
Fam172a A T 13: 77,834,675 I135L possibly damaging Het
Fam71e1 C CGGAGGGAGGAAGGCTGGATCCTGGATACCTGGGTA 7: 44,500,527 probably null Het
Flywch1 CCACTCCTGGTGT CCACTCCTGGTGTGGGGAGGCTACGTACTCACACACTCCTGGTGT 17: 23,762,166 probably null Het
Fmn1 ACCTCC ACCTCCCCCTCC 2: 113,525,786 probably benign Het
Fsip2 T A 2: 82,991,521 M5866K probably benign Het
Gnl2 T A 4: 125,043,725 probably null Het
Grip2 C T 6: 91,783,593 R341Q probably benign Het
Hmcn1 T A 1: 150,624,561 H3960L probably damaging Het
Igkv6-25 T A 6: 70,215,778 Y56* probably null Het
Il12a A T 3: 68,695,229 T102S probably benign Het
Il1a T A 2: 129,302,932 I189F possibly damaging Het
Inpp4b T A 8: 81,969,521 Y361* probably null Het
Iqcf4 CTTTTCCTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCATTTTCCTTTTCCTTTT 9: 106,570,607 probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Las1l AGTGG AGTGGTGG X: 95,940,816 probably benign Het
Lrmp AGCACATTG AGCACATTGTGCACATTG 6: 145,173,783 probably benign Het
Lrrc8d T C 5: 105,812,641 Y306H probably damaging Het
Mamld1 AGC AGCCGC X: 71,118,820 probably benign Het
Map1a CTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCA 2: 121,306,296 probably benign Het
Map1b G T 13: 99,430,750 A1821E unknown Het
Maz A G 7: 127,025,497 C284R probably damaging Het
Med23 A G 10: 24,903,785 H920R probably damaging Het
Megf10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 18: 57,294,027 probably benign Het
Mmp14 C T 14: 54,439,014 R339* probably null Het
Mroh9 T G 1: 163,058,061 K334T probably damaging Het
Nab1 A T 1: 52,479,282 C320S probably damaging Het
Noto T C 6: 85,424,210 S74P probably benign Het
Nudt4 T C 10: 95,549,374 N152D possibly damaging Het
Nup155 T TTTTG 15: 8,119,176 probably benign Het
Nusap1 AGCTGAGA AGCTGAGATACACGTTAGCAGTGAGGAGCAGGCTGAGA 2: 119,627,603 probably benign Het
Olfr118 A C 17: 37,672,858 K278N probably damaging Het
Olfr330 CA C 11: 58,529,157 probably null Het
Olfr461 T C 6: 40,544,362 I206V probably benign Het
Olfr585 GTTAT GTTATTAT 7: 103,098,305 Het
Olfr585 TTA TTAGTA 7: 103,098,306 probably null Het
Olfr710 T A 7: 106,944,648 M118L probably damaging Het
Olfr828 T C 9: 18,815,482 T271A probably benign Het
Plxnc1 T C 10: 94,794,444 Y1531C probably damaging Het
Pnmal2 TGA TGAAGA 7: 16,946,016 probably benign Het
Rp1 A G 1: 4,344,694 V2065A probably damaging Het
Sbp AAGATGCTGACAACA AAGATGCTGACAACAGAGATGCTGACAACA 17: 23,945,369 probably benign Het
Sepsecs G A 5: 52,647,191 T379M probably benign Het
Sfswap GGCC GGCCCACTCTGCC 5: 129,569,764 probably benign Het
Six3 GCG GCGTCG 17: 85,621,370 probably benign Het
Tfeb C T 17: 47,788,078 T259I possibly damaging Het
Tgoln1 A AAACTCAG 6: 72,616,352 probably null Het
Tmem94 G A 11: 115,796,132 V1108M probably damaging Het
Usp35 T C 7: 97,322,096 K297E possibly damaging Het
Vcpkmt T A 12: 69,582,824 T55S possibly damaging Het
Zfp384 GCCCAGGCCCAGGCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAGGCCCAGGCCCAG 6: 125,036,471 probably benign Het
Zfp384 GGCCC GGCCCTGGCCCAAGCCC 6: 125,036,476 probably benign Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,036,483 probably benign Het
Zfp407 A T 18: 84,209,563 S1974T probably benign Het
Zfp677 T C 17: 21,397,442 S254P probably damaging Het
Other mutations in Gab3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Gab3 APN X 75005359 missense probably benign 0.00
R0894:Gab3 UTSW X 75033418 missense probably damaging 1.00
R2069:Gab3 UTSW X 75000095 missense probably damaging 1.00
R2102:Gab3 UTSW X 74999979 small insertion probably benign
RF001:Gab3 UTSW X 75000018 small insertion probably benign
RF006:Gab3 UTSW X 75000027 small insertion probably benign
RF007:Gab3 UTSW X 74999996 small insertion probably benign
RF007:Gab3 UTSW X 75000011 small insertion probably benign
RF007:Gab3 UTSW X 75000025 small insertion probably benign
RF009:Gab3 UTSW X 74999992 small insertion probably benign
RF009:Gab3 UTSW X 75000024 nonsense probably null
RF010:Gab3 UTSW X 75000011 small insertion probably benign
RF012:Gab3 UTSW X 75000020 small insertion probably benign
RF016:Gab3 UTSW X 74999985 nonsense probably null
RF020:Gab3 UTSW X 75000017 small insertion probably benign
RF022:Gab3 UTSW X 74999994 nonsense probably null
RF025:Gab3 UTSW X 75000008 small insertion probably benign
RF026:Gab3 UTSW X 74999990 small insertion probably benign
RF026:Gab3 UTSW X 75000023 small insertion probably benign
RF028:Gab3 UTSW X 75000000 nonsense probably null
RF028:Gab3 UTSW X 75000017 small insertion probably benign
RF030:Gab3 UTSW X 74999977 small deletion probably benign
RF030:Gab3 UTSW X 75000005 small insertion probably benign
RF030:Gab3 UTSW X 75000008 small insertion probably benign
RF030:Gab3 UTSW X 75000025 small insertion probably benign
RF030:Gab3 UTSW X 75000026 small insertion probably benign
RF031:Gab3 UTSW X 74999996 small insertion probably benign
RF031:Gab3 UTSW X 74999997 nonsense probably null
RF031:Gab3 UTSW X 75000001 small insertion probably benign
RF033:Gab3 UTSW X 75000001 small insertion probably benign
RF033:Gab3 UTSW X 75000023 small insertion probably benign
RF039:Gab3 UTSW X 75000004 small insertion probably benign
RF040:Gab3 UTSW X 75000027 small insertion probably benign
RF042:Gab3 UTSW X 75000005 small insertion probably benign
RF042:Gab3 UTSW X 75000022 small insertion probably benign
RF044:Gab3 UTSW X 75000005 small insertion probably benign
RF047:Gab3 UTSW X 74999993 small insertion probably benign
RF052:Gab3 UTSW X 74999983 small insertion probably benign
RF055:Gab3 UTSW X 74999987 small insertion probably benign
RF055:Gab3 UTSW X 75000010 small insertion probably benign
RF058:Gab3 UTSW X 75000002 small insertion probably benign
RF059:Gab3 UTSW X 74999990 small insertion probably benign
RF060:Gab3 UTSW X 75000013 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CGGTGACCTGGTTTTATAATAAGC -3'
(R):5'- TTTGGAAGGAACAGGCTCAAAC -3'

Sequencing Primer
(F):5'- AAGCCATTCTTTATGACTGCACAC -3'
(R):5'- GGCTCAAACCCCACAGG -3'
Posted On2019-12-04