Incidental Mutation 'RF004:Nxph2'
ID602674
Institutional Source Beutler Lab
Gene Symbol Nxph2
Ensembl Gene ENSMUSG00000069132
Gene Nameneurexophilin 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #RF004 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location23321246-23401973 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23400068 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 144 (R144Q)
Ref Sequence ENSEMBL: ENSMUSP00000100009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102945]
Predicted Effect probably damaging
Transcript: ENSMUST00000102945
AA Change: R144Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100009
Gene: ENSMUSG00000069132
AA Change: R144Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Neurexophilin 50 261 7.9e-99 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.1%
  • 20x: 97.6%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T A 19: 21,598,281 H126L probably benign Het
4930407I10Rik A T 15: 82,059,349 Q54L possibly damaging Het
4930433I11Rik AACC A 7: 40,993,055 probably benign Het
Adora2a A T 10: 75,333,154 T151S probably benign Het
Ankhd1 GCGGCG GCGGCGTCGGCG 18: 36,560,910 probably benign Het
Ankrd36 A G 11: 5,662,411 K1248E possibly damaging Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Arl11 T C 14: 61,310,855 V38A probably damaging Het
Atp2c2 A T 8: 119,752,822 N726Y probably damaging Het
Bcat1 T C 6: 145,007,623 K413R probably benign Het
Cd244 C G 1: 171,577,922 Q292E probably benign Het
Chp1 T A 2: 119,580,714 D123E probably damaging Het
Cpeb4 ACTCT ACTCTCT 11: 31,927,634 probably benign Het
Ddx6 A G 9: 44,624,492 T173A possibly damaging Het
Dlg2 T A 7: 90,852,677 C66S probably benign Het
Dnah2 T A 11: 69,437,187 Q3370L probably benign Het
Dnmt1 GCACAGTTCCTACCTCGTT GCACAGTTCCTACCTCGTTTTGGGGGCGGAACACAGTTCCTACCTCGTT 9: 20,910,127 probably null Het
Dopey1 T C 9: 86,554,191 V2420A probably benign Het
Gm35339 GAGGAGGA G 15: 76,363,173 probably null Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,754 probably benign Het
Igkv6-25 TTGACGGA T 6: 70,215,663 probably null Het
Iqgap1 G A 7: 80,720,875 A1582V probably benign Het
Lmnb1 T C 18: 56,730,974 I217T possibly damaging Het
Mamld1 CAG CAGTAG X: 71,118,831 probably null Het
Map2k2 A T 10: 81,115,168 H149L probably benign Het
Med12l CAG CAGAAG 3: 59,275,969 probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Olfr330 CA C 11: 58,529,157 probably null Het
Olfr585 GTTAT GTTATTAT 7: 103,098,305 Het
Olfr585 AT ATTCT 7: 103,098,308 probably benign Het
Olfr585 T TTAG 7: 103,098,309 probably null Het
Olfr635 TCC TCCC 7: 103,979,903 probably null Het
Olfr659 A G 7: 104,671,041 E113G probably damaging Het
Olfr924 T C 9: 38,848,818 F235L probably benign Het
Padi4 A T 4: 140,759,958 V211E probably damaging Het
Prdm10 A C 9: 31,359,126 D902A probably damaging Het
Prps1l1 A G 12: 34,985,399 D171G probably damaging Het
Rasal3 A T 17: 32,391,107 N1035K probably damaging Het
Rassf6 GGTCCTGTAGAGCAATGGGGATTC GGTCCTGTAGAGCAATGGGGATTCTGCATCACTCATTGTCCTGTAGAGCAATGGGGATTC 5: 90,608,919 probably benign Het
Rbm26 A G 14: 105,151,495 V320A probably damaging Het
S1pr1 A T 3: 115,712,887 Y19* probably null Het
Slc22a16 A C 10: 40,603,646 L571F possibly damaging Het
Smarca2 CAGC CAGCCCAAGC 19: 26,631,020 probably benign Het
Ssx2ip A T 3: 146,426,440 K219* probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Het
Trav15-2-dv6-2 GAA GAATAA 14: 53,649,754 probably null Het
Trav15-2-dv6-2 AAG AAGCAG 14: 53,649,755 probably benign Het
Tsen15 A G 1: 152,383,719 V63A probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Usp54 T A 14: 20,561,300 E1149D possibly damaging Het
Vmn2r37 A T 7: 9,217,687 S392R probably damaging Het
Zfp663 G T 2: 165,358,443 H72Q probably benign Het
Zfp683 TGTGG TGTGGTGG 4: 134,058,874 probably benign Het
Other mutations in Nxph2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Nxph2 APN 2 23400322 missense probably damaging 1.00
IGL00655:Nxph2 APN 2 23400141 missense possibly damaging 0.53
IGL00861:Nxph2 APN 2 23399962 missense probably damaging 1.00
IGL01358:Nxph2 APN 2 23400074 missense probably damaging 1.00
IGL01733:Nxph2 APN 2 23400125 missense probably benign 0.00
IGL01983:Nxph2 APN 2 23399934 missense probably benign 0.32
IGL02739:Nxph2 APN 2 23399900 missense probably benign 0.06
IGL02983:Nxph2 APN 2 23400362 missense probably damaging 1.00
IGL03013:Nxph2 APN 2 23399933 missense probably benign 0.08
R4392:Nxph2 UTSW 2 23400272 missense probably damaging 0.99
R4796:Nxph2 UTSW 2 23399858 missense probably benign 0.00
R4877:Nxph2 UTSW 2 23399834 missense probably benign 0.00
R5038:Nxph2 UTSW 2 23321544 splice site probably null
R8057:Nxph2 UTSW 2 23400095 missense possibly damaging 0.89
Z1088:Nxph2 UTSW 2 23400217 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GGATTGGCTGGCAAACATAAC -3'
(R):5'- CTGCTCCTGGTAGCAGATTTTG -3'

Sequencing Primer
(F):5'- TGGCTGGCAAACATAACAGAAATTC -3'
(R):5'- TGGATGGGTCGAAATTGCAC -3'
Posted On2019-12-04