Incidental Mutation 'RF004:Rassf6'
ID 602682
Institutional Source Beutler Lab
Gene Symbol Rassf6
Ensembl Gene ENSMUSG00000029370
Gene Name Ras association (RalGDS/AF-6) domain family member 6
Synonyms 1600016B17Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.075) question?
Stock # RF004 (G1)
Quality Score 149.467
Status Not validated
Chromosome 5
Chromosomal Location 90750935-90788516 bp(-) (GRCm39)
Type of Mutation utr 3 prime
DNA Base Change (assembly) GGTCCTGTAGAGCAATGGGGATTC to GGTCCTGTAGAGCAATGGGGATTCTGCATCACTCATTGTCCTGTAGAGCAATGGGGATTC at 90756778 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000031317] [ENSMUST00000202704] [ENSMUST00000202784]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000031317
SMART Domains Protein: ENSMUSP00000031317
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202704
SMART Domains Protein: ENSMUSP00000144532
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202784
SMART Domains Protein: ENSMUSP00000144337
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
low complexity region 126 135 N/A INTRINSIC
RA 175 265 2.67e-9 SMART
Pfam:Nore1-SARAH 277 316 8.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202807
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.1%
  • 20x: 97.6%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-association domain family (RASSF). Members of this family form the core of a highly conserved tumor suppressor network, the Salvador-Warts-Hippo (SWH) pathway. The protein encoded by this gene is a Ras effector protein that induces apoptosis. A genomic region containing this gene has been linked to susceptibility to viral bronchiolitis. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T A 19: 21,575,645 (GRCm39) H126L probably benign Het
4930407I10Rik A T 15: 81,943,550 (GRCm39) Q54L possibly damaging Het
4930433I11Rik AACC A 7: 40,642,479 (GRCm39) probably benign Het
Adora2a A T 10: 75,168,988 (GRCm39) T151S probably benign Het
Ankhd1 GCGGCG GCGGCGTCGGCG 18: 36,693,963 (GRCm39) probably benign Het
Ankrd36 A G 11: 5,612,411 (GRCm39) K1248E possibly damaging Het
Anks1b G A 10: 89,869,087 (GRCm39) G49D probably damaging Het
Arl11 T C 14: 61,548,304 (GRCm39) V38A probably damaging Het
Atp2c2 A T 8: 120,479,561 (GRCm39) N726Y probably damaging Het
Bcat1 T C 6: 144,953,349 (GRCm39) K413R probably benign Het
Cd244a C G 1: 171,405,490 (GRCm39) Q292E probably benign Het
Chp1 T A 2: 119,411,195 (GRCm39) D123E probably damaging Het
Cpeb4 ACTCT ACTCTCT 11: 31,877,634 (GRCm39) probably benign Het
Ddx6 A G 9: 44,535,789 (GRCm39) T173A possibly damaging Het
Dlg2 T A 7: 90,501,885 (GRCm39) C66S probably benign Het
Dnah2 T A 11: 69,328,013 (GRCm39) Q3370L probably benign Het
Dnmt1 GCACAGTTCCTACCTCGTT GCACAGTTCCTACCTCGTTTTGGGGGCGGAACACAGTTCCTACCTCGTT 9: 20,821,423 (GRCm39) probably null Het
Dop1a T C 9: 86,436,244 (GRCm39) V2420A probably benign Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,489,118 (GRCm39) probably benign Het
Igkv6-25 TTGACGGA T 6: 70,192,647 (GRCm39) probably null Het
Iqgap1 G A 7: 80,370,623 (GRCm39) A1582V probably benign Het
Lmnb1 T C 18: 56,864,046 (GRCm39) I217T possibly damaging Het
Mamld1 CAG CAGTAG X: 70,162,437 (GRCm39) probably null Het
Map2k2 A T 10: 80,951,002 (GRCm39) H149L probably benign Het
Med12l CAG CAGAAG 3: 59,183,390 (GRCm39) probably benign Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Nxph2 G A 2: 23,290,080 (GRCm39) R144Q probably damaging Het
Or2t48 CA C 11: 58,419,983 (GRCm39) probably null Het
Or51f1e T TTAG 7: 102,747,516 (GRCm39) probably null Het
Or51f1e GTTAT GTTATTAT 7: 102,747,512 (GRCm39) Het
Or51f1e AT ATTCT 7: 102,747,515 (GRCm39) probably benign Het
Or51q1 TCC TCCC 7: 103,629,110 (GRCm39) probably null Het
Or52n20 A G 7: 104,320,248 (GRCm39) E113G probably damaging Het
Or8d2 T C 9: 38,760,114 (GRCm39) F235L probably benign Het
Padi4 A T 4: 140,487,269 (GRCm39) V211E probably damaging Het
Prdm10 A C 9: 31,270,422 (GRCm39) D902A probably damaging Het
Prps1l1 A G 12: 35,035,398 (GRCm39) D171G probably damaging Het
Rasal3 A T 17: 32,610,081 (GRCm39) N1035K probably damaging Het
Rbm26 A G 14: 105,388,931 (GRCm39) V320A probably damaging Het
S1pr1 A T 3: 115,506,536 (GRCm39) Y19* probably null Het
Slc22a16 A C 10: 40,479,642 (GRCm39) L571F possibly damaging Het
Smarca2 CAGC CAGCCCAAGC 19: 26,608,420 (GRCm39) probably benign Het
Ssx2ip A T 3: 146,132,195 (GRCm39) K219* probably null Het
Trav15-2-dv6-2 AAG AAGCAG 14: 53,887,212 (GRCm39) probably benign Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,887,207 (GRCm39) probably benign Het
Trav15-2-dv6-2 GAA GAATAA 14: 53,887,211 (GRCm39) probably null Het
Tsen15 A G 1: 152,259,470 (GRCm39) V63A probably damaging Het
Ttc21a A G 9: 119,795,838 (GRCm39) Y1224C probably damaging Het
Usp54 T A 14: 20,611,368 (GRCm39) E1149D possibly damaging Het
Vmn2r37 A T 7: 9,220,686 (GRCm39) S392R probably damaging Het
Wdr97 GAGGAGGA G 15: 76,247,373 (GRCm39) probably null Het
Zfp663 G T 2: 165,200,363 (GRCm39) H72Q probably benign Het
Zfp683 TGTGG TGTGGTGG 4: 133,786,185 (GRCm39) probably benign Het
Other mutations in Rassf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Rassf6 APN 5 90,751,999 (GRCm39) missense probably damaging 1.00
IGL00819:Rassf6 APN 5 90,751,930 (GRCm39) missense probably benign 0.03
IGL01139:Rassf6 APN 5 90,756,825 (GRCm39) makesense probably null
IGL03114:Rassf6 APN 5 90,756,649 (GRCm39) splice site probably benign
R1956:Rassf6 UTSW 5 90,763,730 (GRCm39) nonsense probably null
R2167:Rassf6 UTSW 5 90,751,797 (GRCm39) missense probably damaging 1.00
R2351:Rassf6 UTSW 5 90,779,418 (GRCm39) missense probably benign 0.05
R2877:Rassf6 UTSW 5 90,754,664 (GRCm39) missense probably damaging 1.00
R3943:Rassf6 UTSW 5 90,752,185 (GRCm39) missense possibly damaging 0.49
R3944:Rassf6 UTSW 5 90,752,185 (GRCm39) missense possibly damaging 0.49
R4131:Rassf6 UTSW 5 90,757,646 (GRCm39) missense probably damaging 1.00
R5134:Rassf6 UTSW 5 90,752,225 (GRCm39) critical splice acceptor site probably null
R5153:Rassf6 UTSW 5 90,754,699 (GRCm39) missense possibly damaging 0.81
R5633:Rassf6 UTSW 5 90,751,977 (GRCm39) missense possibly damaging 0.84
R5994:Rassf6 UTSW 5 90,765,627 (GRCm39) missense probably damaging 1.00
R6000:Rassf6 UTSW 5 90,751,736 (GRCm39) missense probably damaging 1.00
R6746:Rassf6 UTSW 5 90,757,633 (GRCm39) missense possibly damaging 0.80
R7038:Rassf6 UTSW 5 90,757,584 (GRCm39) missense probably benign 0.13
R7190:Rassf6 UTSW 5 90,754,666 (GRCm39) missense probably damaging 1.00
R7549:Rassf6 UTSW 5 90,754,661 (GRCm39) missense probably damaging 1.00
R8497:Rassf6 UTSW 5 90,779,391 (GRCm39) missense possibly damaging 0.83
R9472:Rassf6 UTSW 5 90,765,572 (GRCm39) nonsense probably null
RF002:Rassf6 UTSW 5 90,756,784 (GRCm39) nonsense probably null
RF002:Rassf6 UTSW 5 90,756,780 (GRCm39) utr 3 prime probably benign
RF011:Rassf6 UTSW 5 90,756,780 (GRCm39) utr 3 prime probably benign
RF013:Rassf6 UTSW 5 90,756,800 (GRCm39) utr 3 prime probably benign
RF018:Rassf6 UTSW 5 90,756,788 (GRCm39) utr 3 prime probably benign
RF032:Rassf6 UTSW 5 90,756,798 (GRCm39) utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90,756,776 (GRCm39) utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90,756,771 (GRCm39) utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90,756,782 (GRCm39) utr 3 prime probably benign
RF035:Rassf6 UTSW 5 90,756,767 (GRCm39) utr 3 prime probably benign
RF036:Rassf6 UTSW 5 90,756,774 (GRCm39) utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90,756,789 (GRCm39) utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90,756,783 (GRCm39) utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90,756,798 (GRCm39) utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90,756,774 (GRCm39) utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90,756,798 (GRCm39) utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90,756,791 (GRCm39) utr 3 prime probably benign
RF049:Rassf6 UTSW 5 90,756,772 (GRCm39) utr 3 prime probably benign
RF051:Rassf6 UTSW 5 90,756,788 (GRCm39) utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90,756,782 (GRCm39) utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90,756,775 (GRCm39) utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90,756,790 (GRCm39) utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90,756,783 (GRCm39) utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90,756,770 (GRCm39) utr 3 prime probably benign
RF063:Rassf6 UTSW 5 90,756,801 (GRCm39) nonsense probably null
X0017:Rassf6 UTSW 5 90,754,648 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGGCATCTGCTACCGCTG -3'
(R):5'- GCCAGGAAATAGCAGTCATTC -3'

Sequencing Primer
(F):5'- CCGCTGTTATTACTAACTTGAATGC -3'
(R):5'- TCTTGTTAATAAAAGCACGCCAGCG -3'
Posted On 2019-12-04