Incidental Mutation 'RF004:Rassf6'
ID602682
Institutional Source Beutler Lab
Gene Symbol Rassf6
Ensembl Gene ENSMUSG00000029370
Gene NameRas association (RalGDS/AF-6) domain family member 6
Synonyms1600016B17Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #RF004 (G1)
Quality Score149.467
Status Not validated
Chromosome5
Chromosomal Location90603076-90640657 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) GGTCCTGTAGAGCAATGGGGATTC to GGTCCTGTAGAGCAATGGGGATTCTGCATCACTCATTGTCCTGTAGAGCAATGGGGATTC at 90608919 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000031317] [ENSMUST00000202704] [ENSMUST00000202784]
Predicted Effect probably benign
Transcript: ENSMUST00000031317
SMART Domains Protein: ENSMUSP00000031317
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202704
SMART Domains Protein: ENSMUSP00000144532
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202784
SMART Domains Protein: ENSMUSP00000144337
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
low complexity region 126 135 N/A INTRINSIC
RA 175 265 2.67e-9 SMART
Pfam:Nore1-SARAH 277 316 8.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202807
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.1%
  • 20x: 97.6%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-association domain family (RASSF). Members of this family form the core of a highly conserved tumor suppressor network, the Salvador-Warts-Hippo (SWH) pathway. The protein encoded by this gene is a Ras effector protein that induces apoptosis. A genomic region containing this gene has been linked to susceptibility to viral bronchiolitis. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T A 19: 21,598,281 H126L probably benign Het
4930407I10Rik A T 15: 82,059,349 Q54L possibly damaging Het
4930433I11Rik AACC A 7: 40,993,055 probably benign Het
Adora2a A T 10: 75,333,154 T151S probably benign Het
Ankhd1 GCGGCG GCGGCGTCGGCG 18: 36,560,910 probably benign Het
Ankrd36 A G 11: 5,662,411 K1248E possibly damaging Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Arl11 T C 14: 61,310,855 V38A probably damaging Het
Atp2c2 A T 8: 119,752,822 N726Y probably damaging Het
Bcat1 T C 6: 145,007,623 K413R probably benign Het
Cd244 C G 1: 171,577,922 Q292E probably benign Het
Chp1 T A 2: 119,580,714 D123E probably damaging Het
Cpeb4 ACTCT ACTCTCT 11: 31,927,634 probably benign Het
Ddx6 A G 9: 44,624,492 T173A possibly damaging Het
Dlg2 T A 7: 90,852,677 C66S probably benign Het
Dnah2 T A 11: 69,437,187 Q3370L probably benign Het
Dnmt1 GCACAGTTCCTACCTCGTT GCACAGTTCCTACCTCGTTTTGGGGGCGGAACACAGTTCCTACCTCGTT 9: 20,910,127 probably null Het
Dopey1 T C 9: 86,554,191 V2420A probably benign Het
Gm35339 GAGGAGGA G 15: 76,363,173 probably null Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,754 probably benign Het
Igkv6-25 TTGACGGA T 6: 70,215,663 probably null Het
Iqgap1 G A 7: 80,720,875 A1582V probably benign Het
Lmnb1 T C 18: 56,730,974 I217T possibly damaging Het
Mamld1 CAG CAGTAG X: 71,118,831 probably null Het
Map2k2 A T 10: 81,115,168 H149L probably benign Het
Med12l CAG CAGAAG 3: 59,275,969 probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nxph2 G A 2: 23,400,068 R144Q probably damaging Het
Olfr330 CA C 11: 58,529,157 probably null Het
Olfr585 GTTAT GTTATTAT 7: 103,098,305 Het
Olfr585 AT ATTCT 7: 103,098,308 probably benign Het
Olfr585 T TTAG 7: 103,098,309 probably null Het
Olfr635 TCC TCCC 7: 103,979,903 probably null Het
Olfr659 A G 7: 104,671,041 E113G probably damaging Het
Olfr924 T C 9: 38,848,818 F235L probably benign Het
Padi4 A T 4: 140,759,958 V211E probably damaging Het
Prdm10 A C 9: 31,359,126 D902A probably damaging Het
Prps1l1 A G 12: 34,985,399 D171G probably damaging Het
Rasal3 A T 17: 32,391,107 N1035K probably damaging Het
Rbm26 A G 14: 105,151,495 V320A probably damaging Het
S1pr1 A T 3: 115,712,887 Y19* probably null Het
Slc22a16 A C 10: 40,603,646 L571F possibly damaging Het
Smarca2 CAGC CAGCCCAAGC 19: 26,631,020 probably benign Het
Ssx2ip A T 3: 146,426,440 K219* probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Het
Trav15-2-dv6-2 GAA GAATAA 14: 53,649,754 probably null Het
Trav15-2-dv6-2 AAG AAGCAG 14: 53,649,755 probably benign Het
Tsen15 A G 1: 152,383,719 V63A probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Usp54 T A 14: 20,561,300 E1149D possibly damaging Het
Vmn2r37 A T 7: 9,217,687 S392R probably damaging Het
Zfp663 G T 2: 165,358,443 H72Q probably benign Het
Zfp683 TGTGG TGTGGTGG 4: 134,058,874 probably benign Het
Other mutations in Rassf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Rassf6 APN 5 90604140 missense probably damaging 1.00
IGL00819:Rassf6 APN 5 90604071 missense probably benign 0.03
IGL01139:Rassf6 APN 5 90608966 makesense probably null
IGL03114:Rassf6 APN 5 90608790 splice site probably benign
R1956:Rassf6 UTSW 5 90615871 nonsense probably null
R2167:Rassf6 UTSW 5 90603938 missense probably damaging 1.00
R2351:Rassf6 UTSW 5 90631559 missense probably benign 0.05
R2877:Rassf6 UTSW 5 90606805 missense probably damaging 1.00
R3943:Rassf6 UTSW 5 90604326 missense possibly damaging 0.49
R3944:Rassf6 UTSW 5 90604326 missense possibly damaging 0.49
R4131:Rassf6 UTSW 5 90609787 missense probably damaging 1.00
R5134:Rassf6 UTSW 5 90604366 critical splice acceptor site probably null
R5153:Rassf6 UTSW 5 90606840 missense possibly damaging 0.81
R5633:Rassf6 UTSW 5 90604118 missense possibly damaging 0.84
R5994:Rassf6 UTSW 5 90617768 missense probably damaging 1.00
R6000:Rassf6 UTSW 5 90603877 missense probably damaging 1.00
R6746:Rassf6 UTSW 5 90609774 missense possibly damaging 0.80
R7038:Rassf6 UTSW 5 90609725 missense probably benign 0.13
R7190:Rassf6 UTSW 5 90606807 missense probably damaging 1.00
R7549:Rassf6 UTSW 5 90606802 missense probably damaging 1.00
RF002:Rassf6 UTSW 5 90608921 utr 3 prime probably benign
RF002:Rassf6 UTSW 5 90608925 nonsense probably null
RF011:Rassf6 UTSW 5 90608921 utr 3 prime probably benign
RF013:Rassf6 UTSW 5 90608941 utr 3 prime probably benign
RF018:Rassf6 UTSW 5 90608929 utr 3 prime probably benign
RF032:Rassf6 UTSW 5 90608939 utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90608912 utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90608917 utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90608923 utr 3 prime probably benign
RF035:Rassf6 UTSW 5 90608908 utr 3 prime probably benign
RF036:Rassf6 UTSW 5 90608915 utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90608924 utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90608930 utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90608915 utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90608939 utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90608932 utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90608939 utr 3 prime probably benign
RF049:Rassf6 UTSW 5 90608913 utr 3 prime probably benign
RF051:Rassf6 UTSW 5 90608929 utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90608916 utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90608923 utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90608911 utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90608924 utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90608931 utr 3 prime probably benign
RF063:Rassf6 UTSW 5 90608942 nonsense probably null
X0017:Rassf6 UTSW 5 90606789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGGCATCTGCTACCGCTG -3'
(R):5'- GCCAGGAAATAGCAGTCATTC -3'

Sequencing Primer
(F):5'- CCGCTGTTATTACTAACTTGAATGC -3'
(R):5'- TCTTGTTAATAAAAGCACGCCAGCG -3'
Posted On2019-12-04