Incidental Mutation 'RF004:Olfr635'
ID602692
Institutional Source Beutler Lab
Gene Symbol Olfr635
Ensembl Gene ENSMUSG00000094520
Gene Nameolfactory receptor 635
SynonymsGA_x6K02T2PBJ9-6713641-6714588, MOR5-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #RF004 (G1)
Quality Score217.468
Status Not validated
Chromosome7
Chromosomal Location103971152-103987540 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TCC to TCCC at 103979903 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098185] [ENSMUST00000209473]
Predicted Effect probably null
Transcript: ENSMUST00000098185
SMART Domains Protein: ENSMUSP00000095788
Gene: ENSMUSG00000094520

DomainStartEndE-ValueType
Pfam:7tm_4 39 318 1.2e-119 PFAM
Pfam:7TM_GPCR_Srsx 43 182 1.3e-9 PFAM
Pfam:7tm_1 49 300 1.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121874
Predicted Effect probably null
Transcript: ENSMUST00000209473
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.1%
  • 20x: 97.6%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T A 19: 21,598,281 H126L probably benign Het
4930407I10Rik A T 15: 82,059,349 Q54L possibly damaging Het
4930433I11Rik AACC A 7: 40,993,055 probably benign Het
Adora2a A T 10: 75,333,154 T151S probably benign Het
Ankhd1 GCGGCG GCGGCGTCGGCG 18: 36,560,910 probably benign Het
Ankrd36 A G 11: 5,662,411 K1248E possibly damaging Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Arl11 T C 14: 61,310,855 V38A probably damaging Het
Atp2c2 A T 8: 119,752,822 N726Y probably damaging Het
Bcat1 T C 6: 145,007,623 K413R probably benign Het
Cd244 C G 1: 171,577,922 Q292E probably benign Het
Chp1 T A 2: 119,580,714 D123E probably damaging Het
Cpeb4 ACTCT ACTCTCT 11: 31,927,634 probably benign Het
Ddx6 A G 9: 44,624,492 T173A possibly damaging Het
Dlg2 T A 7: 90,852,677 C66S probably benign Het
Dnah2 T A 11: 69,437,187 Q3370L probably benign Het
Dnmt1 GCACAGTTCCTACCTCGTT GCACAGTTCCTACCTCGTTTTGGGGGCGGAACACAGTTCCTACCTCGTT 9: 20,910,127 probably null Het
Dopey1 T C 9: 86,554,191 V2420A probably benign Het
Gm35339 GAGGAGGA G 15: 76,363,173 probably null Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,754 probably benign Het
Igkv6-25 TTGACGGA T 6: 70,215,663 probably null Het
Iqgap1 G A 7: 80,720,875 A1582V probably benign Het
Lmnb1 T C 18: 56,730,974 I217T possibly damaging Het
Mamld1 CAG CAGTAG X: 71,118,831 probably null Het
Map2k2 A T 10: 81,115,168 H149L probably benign Het
Med12l CAG CAGAAG 3: 59,275,969 probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nxph2 G A 2: 23,400,068 R144Q probably damaging Het
Olfr330 CA C 11: 58,529,157 probably null Het
Olfr585 GTTAT GTTATTAT 7: 103,098,305 Het
Olfr585 AT ATTCT 7: 103,098,308 probably benign Het
Olfr585 T TTAG 7: 103,098,309 probably null Het
Olfr659 A G 7: 104,671,041 E113G probably damaging Het
Olfr924 T C 9: 38,848,818 F235L probably benign Het
Padi4 A T 4: 140,759,958 V211E probably damaging Het
Prdm10 A C 9: 31,359,126 D902A probably damaging Het
Prps1l1 A G 12: 34,985,399 D171G probably damaging Het
Rasal3 A T 17: 32,391,107 N1035K probably damaging Het
Rassf6 GGTCCTGTAGAGCAATGGGGATTC GGTCCTGTAGAGCAATGGGGATTCTGCATCACTCATTGTCCTGTAGAGCAATGGGGATTC 5: 90,608,919 probably benign Het
Rbm26 A G 14: 105,151,495 V320A probably damaging Het
S1pr1 A T 3: 115,712,887 Y19* probably null Het
Slc22a16 A C 10: 40,603,646 L571F possibly damaging Het
Smarca2 CAGC CAGCCCAAGC 19: 26,631,020 probably benign Het
Ssx2ip A T 3: 146,426,440 K219* probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Het
Trav15-2-dv6-2 GAA GAATAA 14: 53,649,754 probably null Het
Trav15-2-dv6-2 AAG AAGCAG 14: 53,649,755 probably benign Het
Tsen15 A G 1: 152,383,719 V63A probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Usp54 T A 14: 20,561,300 E1149D possibly damaging Het
Vmn2r37 A T 7: 9,217,687 S392R probably damaging Het
Zfp663 G T 2: 165,358,443 H72Q probably benign Het
Zfp683 TGTGG TGTGGTGG 4: 134,058,874 probably benign Het
Other mutations in Olfr635
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Olfr635 APN 7 103979792 missense probably benign 0.09
IGL01330:Olfr635 APN 7 103980142 utr 3 prime probably benign
IGL01433:Olfr635 APN 7 103979332 missense probably damaging 1.00
FR4304:Olfr635 UTSW 7 103979903 frame shift probably null
FR4340:Olfr635 UTSW 7 103979903 frame shift probably null
FR4342:Olfr635 UTSW 7 103979903 frame shift probably null
R0271:Olfr635 UTSW 7 103979630 missense possibly damaging 0.83
R1909:Olfr635 UTSW 7 103979790 nonsense probably null
R2212:Olfr635 UTSW 7 103979402 missense probably damaging 0.98
R2484:Olfr635 UTSW 7 103979338 missense probably benign
R3412:Olfr635 UTSW 7 103979402 missense probably damaging 0.98
R4513:Olfr635 UTSW 7 103979441 missense probably benign 0.03
R4559:Olfr635 UTSW 7 103979560 missense probably damaging 1.00
R5032:Olfr635 UTSW 7 103979374 missense probably damaging 0.98
R5436:Olfr635 UTSW 7 103979266 missense probably benign
R5591:Olfr635 UTSW 7 103980113 missense probably benign 0.00
R5617:Olfr635 UTSW 7 103979714 missense possibly damaging 0.91
R5911:Olfr635 UTSW 7 103979708 missense probably benign
R6249:Olfr635 UTSW 7 103979611 missense possibly damaging 0.85
R6275:Olfr635 UTSW 7 103979974 missense probably damaging 1.00
R6806:Olfr635 UTSW 7 103979564 missense possibly damaging 0.72
R7589:Olfr635 UTSW 7 103979791 missense probably damaging 1.00
R8188:Olfr635 UTSW 7 103979536 missense probably damaging 1.00
R8337:Olfr635 UTSW 7 103979374 missense probably damaging 0.98
RF005:Olfr635 UTSW 7 103979561 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTTGGCCATCATTTGCC -3'
(R):5'- TCCTTGACGGATCTGCTTTG -3'

Sequencing Primer
(F):5'- GGCCATCATTTGCCGCTGTG -3'
(R):5'- CTTTACACTGTAAATGATGGGGTTC -3'
Posted On2019-12-04