Incidental Mutation 'RF004:Slc22a16'
ID602702
Institutional Source Beutler Lab
Gene Symbol Slc22a16
Ensembl Gene ENSMUSG00000019834
Gene Namesolute carrier family 22 (organic cation transporter), member 16
SynonymsOKB1, FLIPT2, OCT6, CT2, 4921504E14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #RF004 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location40570336-40604132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 40603646 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 571 (L571F)
Ref Sequence ENSEMBL: ENSMUSP00000019978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019978] [ENSMUST00000078314]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019978
AA Change: L571F

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000019978
Gene: ENSMUSG00000019834
AA Change: L571F

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
Pfam:Sugar_tr 136 556 6.4e-25 PFAM
Pfam:MFS_1 177 514 3.1e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000078314
AA Change: L550F

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077428
Gene: ENSMUSG00000019834
AA Change: L550F

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Sugar_tr 114 535 5.1e-26 PFAM
Pfam:MFS_1 156 493 4.7e-20 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.1%
  • 20x: 97.6%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the organic zwitterion transporter protein family which transports carnitine. The encoded protein has also been shown to transport anticancer drugs like bleomycin (PMID: 20037140) successful treatment has been correlated with the level of activity of this transporter in tumor cells. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T A 19: 21,598,281 H126L probably benign Het
4930407I10Rik A T 15: 82,059,349 Q54L possibly damaging Het
4930433I11Rik AACC A 7: 40,993,055 probably benign Het
Adora2a A T 10: 75,333,154 T151S probably benign Het
Ankhd1 GCGGCG GCGGCGTCGGCG 18: 36,560,910 probably benign Het
Ankrd36 A G 11: 5,662,411 K1248E possibly damaging Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Arl11 T C 14: 61,310,855 V38A probably damaging Het
Atp2c2 A T 8: 119,752,822 N726Y probably damaging Het
Bcat1 T C 6: 145,007,623 K413R probably benign Het
Cd244 C G 1: 171,577,922 Q292E probably benign Het
Chp1 T A 2: 119,580,714 D123E probably damaging Het
Cpeb4 ACTCT ACTCTCT 11: 31,927,634 probably benign Het
Ddx6 A G 9: 44,624,492 T173A possibly damaging Het
Dlg2 T A 7: 90,852,677 C66S probably benign Het
Dnah2 T A 11: 69,437,187 Q3370L probably benign Het
Dnmt1 GCACAGTTCCTACCTCGTT GCACAGTTCCTACCTCGTTTTGGGGGCGGAACACAGTTCCTACCTCGTT 9: 20,910,127 probably null Het
Dopey1 T C 9: 86,554,191 V2420A probably benign Het
Gm35339 GAGGAGGA G 15: 76,363,173 probably null Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,754 probably benign Het
Igkv6-25 TTGACGGA T 6: 70,215,663 probably null Het
Iqgap1 G A 7: 80,720,875 A1582V probably benign Het
Lmnb1 T C 18: 56,730,974 I217T possibly damaging Het
Mamld1 CAG CAGTAG X: 71,118,831 probably null Het
Map2k2 A T 10: 81,115,168 H149L probably benign Het
Med12l CAG CAGAAG 3: 59,275,969 probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nxph2 G A 2: 23,400,068 R144Q probably damaging Het
Olfr330 CA C 11: 58,529,157 probably null Het
Olfr585 GTTAT GTTATTAT 7: 103,098,305 Het
Olfr585 AT ATTCT 7: 103,098,308 probably benign Het
Olfr585 T TTAG 7: 103,098,309 probably null Het
Olfr635 TCC TCCC 7: 103,979,903 probably null Het
Olfr659 A G 7: 104,671,041 E113G probably damaging Het
Olfr924 T C 9: 38,848,818 F235L probably benign Het
Padi4 A T 4: 140,759,958 V211E probably damaging Het
Prdm10 A C 9: 31,359,126 D902A probably damaging Het
Prps1l1 A G 12: 34,985,399 D171G probably damaging Het
Rasal3 A T 17: 32,391,107 N1035K probably damaging Het
Rassf6 GGTCCTGTAGAGCAATGGGGATTC GGTCCTGTAGAGCAATGGGGATTCTGCATCACTCATTGTCCTGTAGAGCAATGGGGATTC 5: 90,608,919 probably benign Het
Rbm26 A G 14: 105,151,495 V320A probably damaging Het
S1pr1 A T 3: 115,712,887 Y19* probably null Het
Smarca2 CAGC CAGCCCAAGC 19: 26,631,020 probably benign Het
Ssx2ip A T 3: 146,426,440 K219* probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Het
Trav15-2-dv6-2 GAA GAATAA 14: 53,649,754 probably null Het
Trav15-2-dv6-2 AAG AAGCAG 14: 53,649,755 probably benign Het
Tsen15 A G 1: 152,383,719 V63A probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Usp54 T A 14: 20,561,300 E1149D possibly damaging Het
Vmn2r37 A T 7: 9,217,687 S392R probably damaging Het
Zfp663 G T 2: 165,358,443 H72Q probably benign Het
Zfp683 TGTGG TGTGGTGG 4: 134,058,874 probably benign Het
Other mutations in Slc22a16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Slc22a16 APN 10 40595282 missense probably damaging 1.00
IGL00334:Slc22a16 APN 10 40573934 missense probably benign 0.03
IGL00757:Slc22a16 APN 10 40581327 missense probably damaging 1.00
IGL01082:Slc22a16 APN 10 40573864 missense probably benign 0.40
IGL01337:Slc22a16 APN 10 40595314 missense possibly damaging 0.51
IGL01389:Slc22a16 APN 10 40585135 missense probably damaging 1.00
IGL01405:Slc22a16 APN 10 40585195 missense probably benign 0.36
IGL01667:Slc22a16 APN 10 40585018 missense probably damaging 1.00
IGL01700:Slc22a16 APN 10 40603908 missense unknown
IGL01792:Slc22a16 APN 10 40573932 missense possibly damaging 0.51
IGL02948:Slc22a16 APN 10 40573962 nonsense probably null
IGL03178:Slc22a16 APN 10 40573760 missense probably benign 0.09
PIT4418001:Slc22a16 UTSW 10 40603825 missense unknown
R0358:Slc22a16 UTSW 10 40587492 splice site probably null
R0422:Slc22a16 UTSW 10 40591890 missense probably damaging 1.00
R0497:Slc22a16 UTSW 10 40584967 missense probably damaging 1.00
R1435:Slc22a16 UTSW 10 40587607 missense probably damaging 1.00
R1577:Slc22a16 UTSW 10 40603815 nonsense probably null
R1696:Slc22a16 UTSW 10 40584927 missense possibly damaging 0.75
R2022:Slc22a16 UTSW 10 40591877 missense probably damaging 1.00
R2065:Slc22a16 UTSW 10 40585020 missense possibly damaging 0.63
R2082:Slc22a16 UTSW 10 40585339 missense probably benign 0.02
R4083:Slc22a16 UTSW 10 40574069 missense probably damaging 1.00
R4588:Slc22a16 UTSW 10 40570681 intron probably benign
R4828:Slc22a16 UTSW 10 40573640 missense probably damaging 1.00
R4853:Slc22a16 UTSW 10 40574051 missense probably damaging 0.98
R5127:Slc22a16 UTSW 10 40573957 missense probably benign 0.21
R5215:Slc22a16 UTSW 10 40581390 missense probably damaging 1.00
R5590:Slc22a16 UTSW 10 40581341 missense possibly damaging 0.94
R5626:Slc22a16 UTSW 10 40584853 critical splice acceptor site probably null
R5810:Slc22a16 UTSW 10 40595318 missense possibly damaging 0.86
R6675:Slc22a16 UTSW 10 40573840 nonsense probably null
R6692:Slc22a16 UTSW 10 40603905 missense unknown
R6738:Slc22a16 UTSW 10 40585302 missense probably damaging 0.99
R7158:Slc22a16 UTSW 10 40573741 missense possibly damaging 0.66
R7685:Slc22a16 UTSW 10 40574089 missense possibly damaging 0.73
R7883:Slc22a16 UTSW 10 40603664 missense probably benign 0.01
R8332:Slc22a16 UTSW 10 40573745 missense possibly damaging 0.94
R8733:Slc22a16 UTSW 10 40574065 missense probably benign 0.16
Z1177:Slc22a16 UTSW 10 40585156 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCTGAATCAGGTCCGGTAC -3'
(R):5'- CAAGAGAAGCTCTGCCTGAAGC -3'

Sequencing Primer
(F):5'- GAATCAGGTCCGGTACTTCTTATTC -3'
(R):5'- TGAAGCACCCCTCTCAGTC -3'
Posted On2019-12-04