Incidental Mutation 'RF004:Cpeb4'
ID602708
Institutional Source Beutler Lab
Gene Symbol Cpeb4
Ensembl Gene ENSMUSG00000020300
Gene Namecytoplasmic polyadenylation element binding protein 4
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.441) question?
Stock #RF004 (G1)
Quality Score136.457
Status Not validated
Chromosome11
Chromosomal Location31872211-31935634 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) ACTCT to ACTCTCT at 31927634 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020543] [ENSMUST00000109412] [ENSMUST00000155278]
Predicted Effect probably benign
Transcript: ENSMUST00000020543
SMART Domains Protein: ENSMUSP00000020543
Gene: ENSMUSG00000020300

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 46 59 N/A INTRINSIC
low complexity region 83 96 N/A INTRINSIC
low complexity region 172 183 N/A INTRINSIC
low complexity region 230 249 N/A INTRINSIC
low complexity region 281 314 N/A INTRINSIC
RRM 473 545 4.3e-5 SMART
RRM 581 654 1.11e-2 SMART
PDB:2M13|A 655 720 3e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000109412
SMART Domains Protein: ENSMUSP00000105039
Gene: ENSMUSG00000020300

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 46 59 N/A INTRINSIC
low complexity region 83 96 N/A INTRINSIC
low complexity region 172 183 N/A INTRINSIC
low complexity region 230 249 N/A INTRINSIC
low complexity region 281 314 N/A INTRINSIC
RRM 456 528 4.3e-5 SMART
RRM 564 637 1.11e-2 SMART
PDB:2M13|A 638 703 3e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000155278
SMART Domains Protein: ENSMUSP00000116753
Gene: ENSMUSG00000020300

DomainStartEndE-ValueType
RRM 136 208 4.3e-5 SMART
RRM 244 317 1.11e-2 SMART
PDB:2M13|A 318 383 2e-7 PDB
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.1%
  • 20x: 97.6%
Validation Efficiency 100% (34/34)
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show slightly longer dendritic spines but normal hippocampal synaptic plasticity and memory. Homozygotes for a different null allele show neo- and postnatal lethality, erythropoiesis, suckling and mobility defects, and reduced motor axon branching and NMJ formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T A 19: 21,598,281 H126L probably benign Het
4930407I10Rik A T 15: 82,059,349 Q54L possibly damaging Het
4930433I11Rik AACC A 7: 40,993,055 probably benign Het
Adora2a A T 10: 75,333,154 T151S probably benign Het
Ankhd1 GCGGCG GCGGCGTCGGCG 18: 36,560,910 probably benign Het
Ankrd36 A G 11: 5,662,411 K1248E possibly damaging Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Arl11 T C 14: 61,310,855 V38A probably damaging Het
Atp2c2 A T 8: 119,752,822 N726Y probably damaging Het
Bcat1 T C 6: 145,007,623 K413R probably benign Het
Cd244 C G 1: 171,577,922 Q292E probably benign Het
Chp1 T A 2: 119,580,714 D123E probably damaging Het
Ddx6 A G 9: 44,624,492 T173A possibly damaging Het
Dlg2 T A 7: 90,852,677 C66S probably benign Het
Dnah2 T A 11: 69,437,187 Q3370L probably benign Het
Dnmt1 GCACAGTTCCTACCTCGTT GCACAGTTCCTACCTCGTTTTGGGGGCGGAACACAGTTCCTACCTCGTT 9: 20,910,127 probably null Het
Dopey1 T C 9: 86,554,191 V2420A probably benign Het
Gm35339 GAGGAGGA G 15: 76,363,173 probably null Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,754 probably benign Het
Igkv6-25 TTGACGGA T 6: 70,215,663 probably null Het
Iqgap1 G A 7: 80,720,875 A1582V probably benign Het
Lmnb1 T C 18: 56,730,974 I217T possibly damaging Het
Mamld1 CAG CAGTAG X: 71,118,831 probably null Het
Map2k2 A T 10: 81,115,168 H149L probably benign Het
Med12l CAG CAGAAG 3: 59,275,969 probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nxph2 G A 2: 23,400,068 R144Q probably damaging Het
Olfr330 CA C 11: 58,529,157 probably null Het
Olfr585 GTTAT GTTATTAT 7: 103,098,305 Het
Olfr585 AT ATTCT 7: 103,098,308 probably benign Het
Olfr585 T TTAG 7: 103,098,309 probably null Het
Olfr635 TCC TCCC 7: 103,979,903 probably null Het
Olfr659 A G 7: 104,671,041 E113G probably damaging Het
Olfr924 T C 9: 38,848,818 F235L probably benign Het
Padi4 A T 4: 140,759,958 V211E probably damaging Het
Prdm10 A C 9: 31,359,126 D902A probably damaging Het
Prps1l1 A G 12: 34,985,399 D171G probably damaging Het
Rasal3 A T 17: 32,391,107 N1035K probably damaging Het
Rassf6 GGTCCTGTAGAGCAATGGGGATTC GGTCCTGTAGAGCAATGGGGATTCTGCATCACTCATTGTCCTGTAGAGCAATGGGGATTC 5: 90,608,919 probably benign Het
Rbm26 A G 14: 105,151,495 V320A probably damaging Het
S1pr1 A T 3: 115,712,887 Y19* probably null Het
Slc22a16 A C 10: 40,603,646 L571F possibly damaging Het
Smarca2 CAGC CAGCCCAAGC 19: 26,631,020 probably benign Het
Ssx2ip A T 3: 146,426,440 K219* probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Het
Trav15-2-dv6-2 GAA GAATAA 14: 53,649,754 probably null Het
Trav15-2-dv6-2 AAG AAGCAG 14: 53,649,755 probably benign Het
Tsen15 A G 1: 152,383,719 V63A probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Usp54 T A 14: 20,561,300 E1149D possibly damaging Het
Vmn2r37 A T 7: 9,217,687 S392R probably damaging Het
Zfp663 G T 2: 165,358,443 H72Q probably benign Het
Zfp683 TGTGG TGTGGTGG 4: 134,058,874 probably benign Het
Other mutations in Cpeb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Cpeb4 APN 11 31873204 missense probably damaging 1.00
IGL02329:Cpeb4 APN 11 31872316 missense possibly damaging 0.94
IGL02396:Cpeb4 APN 11 31925441 missense probably benign 0.38
IGL03304:Cpeb4 APN 11 31872739 missense probably damaging 1.00
FR4304:Cpeb4 UTSW 11 31927638 critical splice acceptor site probably benign
FR4342:Cpeb4 UTSW 11 31927638 critical splice acceptor site probably benign
R1174:Cpeb4 UTSW 11 31920472 missense probably damaging 0.96
R3969:Cpeb4 UTSW 11 31872811 missense possibly damaging 0.95
R4005:Cpeb4 UTSW 11 31925390 missense probably damaging 0.96
R4017:Cpeb4 UTSW 11 31924671 missense probably damaging 1.00
R4539:Cpeb4 UTSW 11 31873206 missense probably damaging 1.00
R4580:Cpeb4 UTSW 11 31927757 critical splice donor site probably null
R4978:Cpeb4 UTSW 11 31931509 missense probably null 0.88
R5632:Cpeb4 UTSW 11 31889877 missense probably damaging 1.00
R5809:Cpeb4 UTSW 11 31872801 missense probably damaging 1.00
R6164:Cpeb4 UTSW 11 31920584 critical splice donor site probably null
R6735:Cpeb4 UTSW 11 31924700 missense probably benign 0.19
R6955:Cpeb4 UTSW 11 31908864 missense possibly damaging 0.90
R7312:Cpeb4 UTSW 11 31931417 missense probably damaging 0.98
R7341:Cpeb4 UTSW 11 31918807 missense possibly damaging 0.86
R7382:Cpeb4 UTSW 11 31872828 missense probably damaging 0.97
R7705:Cpeb4 UTSW 11 31872327 missense probably damaging 0.97
R8387:Cpeb4 UTSW 11 31908877 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTGCCTGGAAATACCCTGAG -3'
(R):5'- AAGCTCCTGGAGTATTTCAGC -3'

Sequencing Primer
(F):5'- ATATCCTGTAAGGCTGGGTAAC -3'
(R):5'- AGCTCCTGGAGTATTTCAGCTTAAG -3'
Posted On2019-12-04