Incidental Mutation 'RF004:4930407I10Rik'
ID602719
Institutional Source Beutler Lab
Gene Symbol 4930407I10Rik
Ensembl Gene ENSMUSG00000075524
Gene NameRIKEN cDNA 4930407I10 gene
SynonymsLOC328573
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #RF004 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location82059151-82066540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82059349 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 54 (Q54L)
Ref Sequence ENSEMBL: ENSMUSP00000097965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100396]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100396
AA Change: Q54L

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097965
Gene: ENSMUSG00000075524
AA Change: Q54L

DomainStartEndE-ValueType
Pfam:DUF4727 25 234 1.1e-109 PFAM
internal_repeat_1 321 406 9.89e-8 PROSPERO
low complexity region 453 465 N/A INTRINSIC
internal_repeat_2 593 707 6.03e-6 PROSPERO
low complexity region 735 752 N/A INTRINSIC
low complexity region 758 773 N/A INTRINSIC
internal_repeat_2 842 958 6.03e-6 PROSPERO
internal_repeat_1 876 962 9.89e-8 PROSPERO
low complexity region 985 996 N/A INTRINSIC
low complexity region 1117 1133 N/A INTRINSIC
low complexity region 1143 1156 N/A INTRINSIC
low complexity region 1199 1208 N/A INTRINSIC
low complexity region 1259 1270 N/A INTRINSIC
low complexity region 1282 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.1%
  • 20x: 97.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T A 19: 21,598,281 H126L probably benign Het
4930433I11Rik AACC A 7: 40,993,055 probably benign Het
Adora2a A T 10: 75,333,154 T151S probably benign Het
Ankhd1 GCGGCG GCGGCGTCGGCG 18: 36,560,910 probably benign Het
Ankrd36 A G 11: 5,662,411 K1248E possibly damaging Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Arl11 T C 14: 61,310,855 V38A probably damaging Het
Atp2c2 A T 8: 119,752,822 N726Y probably damaging Het
Bcat1 T C 6: 145,007,623 K413R probably benign Het
Chp1 T A 2: 119,580,714 D123E probably damaging Het
Cpeb4 ACTCT ACTCTCT 11: 31,927,634 probably benign Het
Ddx6 A G 9: 44,624,492 T173A possibly damaging Het
Dlg2 T A 7: 90,852,677 C66S probably benign Het
Dnah2 T A 11: 69,437,187 Q3370L probably benign Het
Dnmt1 GCACAGTTCCTACCTCGTT GCACAGTTCCTACCTCGTTTTGGGGGCGGAACACAGTTCCTACCTCGTT 9: 20,910,127 probably null Het
Dopey1 T C 9: 86,554,191 V2420A probably benign Het
Gm35339 GAGGAGGA G 15: 76,363,173 probably null Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,754 probably benign Het
Igkv6-25 TTGACGGA T 6: 70,215,663 probably null Het
Iqgap1 G A 7: 80,720,875 A1582V probably benign Het
Lmnb1 T C 18: 56,730,974 I217T possibly damaging Het
Mamld1 CAG CAGTAG X: 71,118,831 probably null Het
Map2k2 A T 10: 81,115,168 H149L probably benign Het
Med12l CAG CAGAAG 3: 59,275,969 probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nxph2 G A 2: 23,400,068 R144Q probably damaging Het
Olfr330 CA C 11: 58,529,157 probably null Het
Olfr585 GTTAT GTTATTAT 7: 103,098,305 Het
Olfr585 AT ATTCT 7: 103,098,308 probably benign Het
Olfr585 T TTAG 7: 103,098,309 probably null Het
Olfr635 TCC TCCC 7: 103,979,903 probably null Het
Olfr659 A G 7: 104,671,041 E113G probably damaging Het
Olfr785 G C 10: 129,410,111 M248I probably benign Het
Olfr924 T C 9: 38,848,818 F235L probably benign Het
Padi4 A T 4: 140,759,958 V211E probably damaging Het
Prdm10 A C 9: 31,359,126 D902A probably damaging Het
Prps1l1 A G 12: 34,985,399 D171G probably damaging Het
Rasal3 A T 17: 32,391,107 N1035K probably damaging Het
Rassf6 GGTCCTGTAGAGCAATGGGGATTC GGTCCTGTAGAGCAATGGGGATTCTGCATCACTCATTGTCCTGTAGAGCAATGGGGATTC 5: 90,608,919 probably benign Het
Rbm26 A G 14: 105,151,495 V320A probably damaging Het
S1pr1 A T 3: 115,712,887 Y19* probably null Het
Slc22a16 A C 10: 40,603,646 L571F possibly damaging Het
Smarca2 CAGC CAGCCCAAGC 19: 26,631,020 probably benign Het
Ssx2ip A T 3: 146,426,440 K219* probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Het
Trav15-2-dv6-2 GAA GAATAA 14: 53,649,754 probably null Het
Trav15-2-dv6-2 AAG AAGCAG 14: 53,649,755 probably benign Het
Tsen15 A G 1: 152,383,719 V63A probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Usp54 T A 14: 20,561,300 E1149D possibly damaging Het
Vmn2r37 A T 7: 9,217,687 S392R probably damaging Het
Zfp663 G T 2: 165,358,443 H72Q probably benign Het
Zfp683 TGTGG TGTGGTGG 4: 134,058,874 probably benign Het
Other mutations in 4930407I10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:4930407I10Rik APN 15 82066380 missense probably benign 0.00
IGL02135:4930407I10Rik APN 15 82065004 missense possibly damaging 0.63
IGL02367:4930407I10Rik APN 15 82065547 missense probably benign 0.00
IGL02626:4930407I10Rik APN 15 82065609 missense probably damaging 0.99
IGL02885:4930407I10Rik APN 15 82063951 missense probably benign 0.36
IGL03199:4930407I10Rik APN 15 82062355 missense possibly damaging 0.65
R0062:4930407I10Rik UTSW 15 82063066 missense probably benign 0.00
R0062:4930407I10Rik UTSW 15 82066303 missense probably damaging 0.98
R0086:4930407I10Rik UTSW 15 82062601 missense probably benign 0.11
R0578:4930407I10Rik UTSW 15 82059355 missense possibly damaging 0.49
R1130:4930407I10Rik UTSW 15 82059360 missense probably benign
R1218:4930407I10Rik UTSW 15 82064152 missense probably benign 0.04
R1942:4930407I10Rik UTSW 15 82065424 missense probably damaging 0.98
R2380:4930407I10Rik UTSW 15 82064835 missense possibly damaging 0.92
R3945:4930407I10Rik UTSW 15 82065400 missense probably damaging 1.00
R4096:4930407I10Rik UTSW 15 82062205 missense probably benign 0.07
R4259:4930407I10Rik UTSW 15 82063726 missense possibly damaging 0.89
R4261:4930407I10Rik UTSW 15 82063726 missense possibly damaging 0.89
R4805:4930407I10Rik UTSW 15 82066427 nonsense probably null
R4992:4930407I10Rik UTSW 15 82064002 missense possibly damaging 0.60
R5094:4930407I10Rik UTSW 15 82062682 missense possibly damaging 0.72
R5161:4930407I10Rik UTSW 15 82063341 nonsense probably null
R5201:4930407I10Rik UTSW 15 82062544 missense probably benign 0.26
R5305:4930407I10Rik UTSW 15 82059219 missense possibly damaging 0.52
R5588:4930407I10Rik UTSW 15 82065216 missense possibly damaging 0.83
R5844:4930407I10Rik UTSW 15 82065864 missense probably benign 0.33
R6007:4930407I10Rik UTSW 15 82062739 missense probably benign 0.13
R6157:4930407I10Rik UTSW 15 82063416 missense possibly damaging 0.67
R6188:4930407I10Rik UTSW 15 82059270 missense probably benign 0.01
R6350:4930407I10Rik UTSW 15 82063563 missense possibly damaging 0.55
R6408:4930407I10Rik UTSW 15 82065106 missense possibly damaging 0.77
R6805:4930407I10Rik UTSW 15 82062543 missense possibly damaging 0.95
R6911:4930407I10Rik UTSW 15 82063867 missense probably benign 0.01
R6962:4930407I10Rik UTSW 15 82064949 missense probably benign 0.14
R7446:4930407I10Rik UTSW 15 82066240 missense probably benign
R7492:4930407I10Rik UTSW 15 82064359 missense possibly damaging 0.63
R7699:4930407I10Rik UTSW 15 82064105 missense probably benign 0.04
R7700:4930407I10Rik UTSW 15 82064105 missense probably benign 0.04
X0011:4930407I10Rik UTSW 15 82059285 missense probably damaging 1.00
X0026:4930407I10Rik UTSW 15 82063311 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACTTACTGAGCCAGCTACATCAG -3'
(R):5'- GTGCTTATACAGAGCAGTCCATG -3'

Sequencing Primer
(F):5'- ACCATCTACCTGACCTAAGCCTTG -3'
(R):5'- GCATGTGGCTAACGTTCA -3'
Posted On2019-12-04