Incidental Mutation 'RF004:Lmnb1'
ID602722
Institutional Source Beutler Lab
Gene Symbol Lmnb1
Ensembl Gene ENSMUSG00000024590
Gene Namelamin B1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF004 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location56707813-56753424 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56730974 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 217 (I217T)
Ref Sequence ENSEMBL: ENSMUSP00000025486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025486]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025486
AA Change: I217T

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025486
Gene: ENSMUSG00000024590
AA Change: I217T

DomainStartEndE-ValueType
Filament 32 388 2.59e-47 SMART
low complexity region 392 414 N/A INTRINSIC
Pfam:LTD 436 546 2.3e-18 PFAM
low complexity region 551 570 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 99.1%
  • 20x: 97.6%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the two B-type lamin proteins and is a component of the nuclear lamina. A duplication of this gene is associated with autosomal dominant adult-onset leukodystrophy (ADLD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mice display neonatal lethality with respiratory distress, abnormal lung, craniofacial, and skeletal morphology, reduced embryo size, impaired cellular proliferation and differentiation, and abnormal nuclear morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T A 19: 21,598,281 H126L probably benign Het
4930407I10Rik A T 15: 82,059,349 Q54L possibly damaging Het
4930433I11Rik AACC A 7: 40,993,055 probably benign Het
Adora2a A T 10: 75,333,154 T151S probably benign Het
Ankhd1 GCGGCG GCGGCGTCGGCG 18: 36,560,910 probably benign Het
Ankrd36 A G 11: 5,662,411 K1248E possibly damaging Het
Anks1b G A 10: 90,033,225 G49D probably damaging Het
Arl11 T C 14: 61,310,855 V38A probably damaging Het
Atp2c2 A T 8: 119,752,822 N726Y probably damaging Het
Bcat1 T C 6: 145,007,623 K413R probably benign Het
Cd244 C G 1: 171,577,922 Q292E probably benign Het
Chp1 T A 2: 119,580,714 D123E probably damaging Het
Cpeb4 ACTCT ACTCTCT 11: 31,927,634 probably benign Het
Ddx6 A G 9: 44,624,492 T173A possibly damaging Het
Dlg2 T A 7: 90,852,677 C66S probably benign Het
Dnah2 T A 11: 69,437,187 Q3370L probably benign Het
Dnmt1 GCACAGTTCCTACCTCGTT GCACAGTTCCTACCTCGTTTTGGGGGCGGAACACAGTTCCTACCTCGTT 9: 20,910,127 probably null Het
Dopey1 T C 9: 86,554,191 V2420A probably benign Het
Gm35339 GAGGAGGA G 15: 76,363,173 probably null Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,754 probably benign Het
Igkv6-25 TTGACGGA T 6: 70,215,663 probably null Het
Iqgap1 G A 7: 80,720,875 A1582V probably benign Het
Mamld1 CAG CAGTAG X: 71,118,831 probably null Het
Map2k2 A T 10: 81,115,168 H149L probably benign Het
Med12l CAG CAGAAG 3: 59,275,969 probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nxph2 G A 2: 23,400,068 R144Q probably damaging Het
Olfr330 CA C 11: 58,529,157 probably null Het
Olfr585 T TTAG 7: 103,098,309 probably null Het
Olfr585 GTTAT GTTATTAT 7: 103,098,305 Het
Olfr585 AT ATTCT 7: 103,098,308 probably benign Het
Olfr635 TCC TCCC 7: 103,979,903 probably null Het
Olfr659 A G 7: 104,671,041 E113G probably damaging Het
Olfr924 T C 9: 38,848,818 F235L probably benign Het
Padi4 A T 4: 140,759,958 V211E probably damaging Het
Prdm10 A C 9: 31,359,126 D902A probably damaging Het
Prps1l1 A G 12: 34,985,399 D171G probably damaging Het
Rasal3 A T 17: 32,391,107 N1035K probably damaging Het
Rassf6 GGTCCTGTAGAGCAATGGGGATTC GGTCCTGTAGAGCAATGGGGATTCTGCATCACTCATTGTCCTGTAGAGCAATGGGGATTC 5: 90,608,919 probably benign Het
Rbm26 A G 14: 105,151,495 V320A probably damaging Het
S1pr1 A T 3: 115,712,887 Y19* probably null Het
Slc22a16 A C 10: 40,603,646 L571F possibly damaging Het
Smarca2 CAGC CAGCCCAAGC 19: 26,631,020 probably benign Het
Ssx2ip A T 3: 146,426,440 K219* probably null Het
Trav15-2-dv6-2 GAA GAATAA 14: 53,649,754 probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Het
Trav15-2-dv6-2 AAG AAGCAG 14: 53,649,755 probably benign Het
Tsen15 A G 1: 152,383,719 V63A probably damaging Het
Ttc21a A G 9: 119,966,772 Y1224C probably damaging Het
Usp54 T A 14: 20,561,300 E1149D possibly damaging Het
Vmn2r37 A T 7: 9,217,687 S392R probably damaging Het
Zfp663 G T 2: 165,358,443 H72Q probably benign Het
Zfp683 TGTGG TGTGGTGG 4: 134,058,874 probably benign Het
Other mutations in Lmnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01536:Lmnb1 APN 18 56740796 missense probably benign 0.37
IGL02139:Lmnb1 APN 18 56749799 missense probably benign 0.00
Katmai UTSW 18 56743276 nonsense probably null
R0446:Lmnb1 UTSW 18 56743259 missense probably benign 0.02
R0696:Lmnb1 UTSW 18 56740721 missense probably damaging 0.99
R1308:Lmnb1 UTSW 18 56728475 missense probably benign 0.06
R1309:Lmnb1 UTSW 18 56739904 frame shift probably null
R1544:Lmnb1 UTSW 18 56749751 missense probably benign 0.08
R2680:Lmnb1 UTSW 18 56731105 missense probably damaging 1.00
R3833:Lmnb1 UTSW 18 56728526 missense probably benign 0.01
R3980:Lmnb1 UTSW 18 56731019 missense probably damaging 1.00
R5820:Lmnb1 UTSW 18 56740786 missense possibly damaging 0.70
R6025:Lmnb1 UTSW 18 56729384 nonsense probably null
R6028:Lmnb1 UTSW 18 56743276 nonsense probably null
R6346:Lmnb1 UTSW 18 56743238 missense probably benign 0.24
R6736:Lmnb1 UTSW 18 56728469 missense probably damaging 1.00
R8013:Lmnb1 UTSW 18 56708359 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGCCATCATGTCGTTAG -3'
(R):5'- CAGCTCTGAGTGTGAGTGAG -3'

Sequencing Primer
(F):5'- ATGTCGTTAGTCACACTCCAGAC -3'
(R):5'- AGTGAGGTGCTGACTGCG -3'
Posted On2019-12-04