Incidental Mutation 'RF005:Zfp451'
ID602728
Institutional Source Beutler Lab
Gene Symbol Zfp451
Ensembl Gene ENSMUSG00000042197
Gene Namezinc finger protein 451
Synonyms4930515K21Rik, Kiaa0576-hp, 4933435G09Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF005 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location33761545-33814595 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 33776792 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 692 (Y692*)
Ref Sequence ENSEMBL: ENSMUSP00000019861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019861] [ENSMUST00000115167] [ENSMUST00000139143] [ENSMUST00000151055] [ENSMUST00000194656]
Predicted Effect probably null
Transcript: ENSMUST00000019861
AA Change: Y692*
SMART Domains Protein: ENSMUSP00000019861
Gene: ENSMUSG00000042197
AA Change: Y692*

DomainStartEndE-ValueType
coiled coil region 81 109 N/A INTRINSIC
ZnF_C2H2 169 195 1.63e1 SMART
ZnF_C2H2 212 232 1.18e2 SMART
ZnF_C2H2 253 277 1.73e0 SMART
ZnF_C2H2 315 335 2.03e2 SMART
ZnF_C2H2 362 385 3.75e1 SMART
ZnF_C2H2 494 517 2.91e-2 SMART
ZnF_C2H2 527 550 5.4e1 SMART
low complexity region 558 577 N/A INTRINSIC
ZnF_C2H2 604 629 1.55e1 SMART
ZnF_C2H2 634 657 2.29e0 SMART
ZnF_C2H2 665 687 1.64e-1 SMART
ZnF_C2H2 751 774 6.75e0 SMART
ZnF_C2H2 787 810 4.94e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115167
SMART Domains Protein: ENSMUSP00000110821
Gene: ENSMUSG00000042197

DomainStartEndE-ValueType
coiled coil region 81 109 N/A INTRINSIC
ZnF_C2H2 169 195 1.63e1 SMART
ZnF_C2H2 212 232 1.18e2 SMART
ZnF_C2H2 253 277 1.73e0 SMART
ZnF_C2H2 315 335 2.03e2 SMART
ZnF_C2H2 362 385 3.75e1 SMART
ZnF_C2H2 494 517 2.91e-2 SMART
ZnF_C2H2 527 550 5.4e1 SMART
low complexity region 558 577 N/A INTRINSIC
ZnF_C2H2 604 629 1.55e1 SMART
ZnF_C2H2 634 657 2.29e0 SMART
ZnF_C2H2 665 687 1.64e-1 SMART
ZnF_C2H2 751 774 6.75e0 SMART
ZnF_C2H2 787 810 4.94e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139143
Predicted Effect probably benign
Transcript: ENSMUST00000151055
Predicted Effect probably benign
Transcript: ENSMUST00000194656
SMART Domains Protein: ENSMUSP00000141813
Gene: ENSMUSG00000042197

DomainStartEndE-ValueType
ZnF_C2H2 127 153 6.9e-2 SMART
ZnF_C2H2 170 190 5e-1 SMART
ZnF_C2H2 211 235 7.2e-3 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency 94% (65/69)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,884 probably benign Het
A030005L19Rik CTGCTG CTGCTGTGGATGCTG 1: 82,913,585 probably benign Het
Abca1 G T 4: 53,049,125 T1651N probably damaging Het
Adamtsl3 A G 7: 82,612,395 T40A Het
Adgra3 A T 5: 50,013,387 probably null Het
Apcs A T 1: 172,894,242 M179K probably damaging Het
Baiap2 G A 11: 119,996,529 E217K possibly damaging Het
Ccdc69 A G 11: 55,060,523 L24P probably damaging Het
Cdh16 T G 8: 104,617,052 N604T probably damaging Het
Cfb C T 17: 34,858,046 V538I possibly damaging Het
Col6a3 A G 1: 90,811,262 S1022P probably benign Het
Cpeb1 A G 7: 81,361,806 L129S possibly damaging Het
Crybg1 A G 10: 44,004,745 V149A probably benign Het
Cyp4f16 C A 17: 32,545,195 probably null Het
Dlg5 G A 14: 24,158,493 Q882* probably null Het
Fsip2 T A 2: 82,992,532 I6203K probably benign Het
Gabre CCGGCT CCGGCTACGGCT X: 72,270,045 probably null Het
Gm17660 A C 5: 104,074,859 probably null Het
Gm9513 T C 9: 36,475,674 S13P possibly damaging Het
Gprc5d A T 6: 135,116,519 L130Q probably damaging Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Hmcn1 T A 1: 150,635,146 K3609* probably null Het
Hsdl2 GCTGCAG GCTGCAGCAGCAGCCACATCTGCAG 4: 59,610,652 probably benign Het
Kl A C 5: 150,953,420 Y235S probably benign Het
Map6d1 G A 16: 20,241,000 T105I probably benign Het
Mast4 GGTGGTGGTGG GGTGGTGGTGGTGGTGG 13: 102,736,307 probably benign Het
Mbd1 TGTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC TATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC 18: 74,273,573 probably benign Het
Mms22l A G 4: 24,517,207 I363V probably benign Het
Myo7a T C 7: 98,093,617 I391V probably benign Het
Nab2 A T 10: 127,664,364 D286E probably benign Het
Nrxn1 G A 17: 90,362,876 R1144C probably damaging Het
Olfr1039 T C 2: 86,131,070 M198V probably benign Het
Olfr592 T C 7: 103,186,691 I30T possibly damaging Het
Olfr635 A G 7: 103,979,561 D123G probably damaging Het
Pan2 G A 10: 128,315,535 E842K probably benign Het
Prex2 A C 1: 11,185,166 D1145A possibly damaging Het
Prop1 A C 11: 50,951,130 Y150D possibly damaging Het
Prp2 AGGCCCACAGCAGCGACCCCCTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC AGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC 6: 132,600,501 probably benign Het
Psip1 T C 4: 83,460,498 I353M probably damaging Het
Rapgef1 C A 2: 29,707,195 probably null Het
Rgl1 G A 1: 152,521,363 S684L probably benign Het
Sbf2 T A 7: 110,317,008 D1552V probably damaging Het
Serpinh1 C T 7: 99,346,203 V391M probably damaging Het
Slc35e4 A T 11: 3,907,960 L215Q possibly damaging Het
Tbl3 TCTT TCTTCTT 17: 24,702,541 probably benign Het
Tex15 T A 8: 33,576,677 M2045K probably benign Het
Tmprss15 T C 16: 78,953,801 *1070W probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Het
Trav15-2-dv6-2 GGAG GGAGGAG 14: 53,649,751 probably benign Het
Trav15-2-dv6-2 GAA GAACAA 14: 53,649,754 probably benign Het
Trim33 GCCCCGGCCCCCG GCCCCG 3: 103,280,212 probably null Het
Triobp GACAA GACAACCCCAGGACTCCCTGTGCCCAACGGAACAA 15: 78,967,061 probably benign Het
Tub C A 7: 109,022,639 Q95K probably benign Het
Uhrf1bp1 A T 17: 27,885,531 D517V probably damaging Het
Usp9y T A Y: 1,435,046 Q261L probably benign Het
Utp20 A T 10: 88,825,457 D29E probably damaging Het
Vill G A 9: 119,060,439 V148M probably damaging Het
Vmn2r120 C T 17: 57,521,991 E535K possibly damaging Het
Zfp599 A C 9: 22,253,884 V65G probably benign Het
Zfp808 T C 13: 62,171,299 V114A probably benign Het
Znrd1as CACCACCACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCACCACCAC 17: 36,965,048 probably benign Het
Other mutations in Zfp451
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Zfp451 APN 1 33786540 intron probably benign
IGL00423:Zfp451 APN 1 33777579 missense probably benign 0.44
IGL00925:Zfp451 APN 1 33776261 unclassified probably benign
IGL00971:Zfp451 APN 1 33783153 missense probably benign 0.01
IGL01521:Zfp451 APN 1 33777331 splice site probably null
IGL01672:Zfp451 APN 1 33762166 missense probably benign 0.33
IGL01826:Zfp451 APN 1 33782162 missense probably damaging 1.00
IGL02298:Zfp451 APN 1 33772921 missense probably damaging 0.98
IGL02343:Zfp451 APN 1 33776493 missense probably damaging 1.00
IGL03150:Zfp451 APN 1 33777454 missense probably damaging 1.00
IGL03257:Zfp451 APN 1 33777048 missense possibly damaging 0.90
R0006:Zfp451 UTSW 1 33802780 intron probably benign
R0068:Zfp451 UTSW 1 33777625 missense probably damaging 1.00
R0068:Zfp451 UTSW 1 33777625 missense probably damaging 1.00
R0358:Zfp451 UTSW 1 33777729 missense probably damaging 1.00
R0441:Zfp451 UTSW 1 33777045 missense probably damaging 0.96
R0483:Zfp451 UTSW 1 33770910 splice site probably benign
R0745:Zfp451 UTSW 1 33770848 nonsense probably null
R1469:Zfp451 UTSW 1 33769813 missense possibly damaging 0.93
R1469:Zfp451 UTSW 1 33769813 missense possibly damaging 0.93
R1486:Zfp451 UTSW 1 33777727 missense probably damaging 0.99
R1774:Zfp451 UTSW 1 33813768 missense probably benign 0.02
R1929:Zfp451 UTSW 1 33782193 missense probably damaging 1.00
R1929:Zfp451 UTSW 1 33783856 missense probably benign 0.12
R1933:Zfp451 UTSW 1 33777822 missense probably damaging 1.00
R2108:Zfp451 UTSW 1 33779167 missense possibly damaging 0.93
R2225:Zfp451 UTSW 1 33770907 splice site probably benign
R2372:Zfp451 UTSW 1 33780052 splice site probably null
R3923:Zfp451 UTSW 1 33779045 missense probably null 1.00
R4295:Zfp451 UTSW 1 33777755 missense probably damaging 0.99
R4409:Zfp451 UTSW 1 33777413 missense probably damaging 1.00
R4617:Zfp451 UTSW 1 33802671 intron probably benign
R4757:Zfp451 UTSW 1 33765858 missense probably damaging 0.98
R4777:Zfp451 UTSW 1 33782105 missense possibly damaging 0.80
R4906:Zfp451 UTSW 1 33805384 missense probably damaging 1.00
R4964:Zfp451 UTSW 1 33777861 missense probably damaging 1.00
R5128:Zfp451 UTSW 1 33802933 intron probably benign
R5129:Zfp451 UTSW 1 33802933 intron probably benign
R5383:Zfp451 UTSW 1 33813806 missense probably damaging 1.00
R5446:Zfp451 UTSW 1 33777528 missense probably damaging 1.00
R6154:Zfp451 UTSW 1 33803546 intron probably benign
R6228:Zfp451 UTSW 1 33803138 intron probably benign
R6272:Zfp451 UTSW 1 33803244 intron probably benign
R6296:Zfp451 UTSW 1 33769817 nonsense probably null
R6321:Zfp451 UTSW 1 33813735 missense probably damaging 1.00
R6445:Zfp451 UTSW 1 33773011 missense probably damaging 1.00
R6528:Zfp451 UTSW 1 33777781 missense probably damaging 1.00
R6562:Zfp451 UTSW 1 33762179 missense possibly damaging 0.90
R6739:Zfp451 UTSW 1 33803594 intron probably benign
R6911:Zfp451 UTSW 1 33803456 intron probably benign
R7042:Zfp451 UTSW 1 33777393 missense probably damaging 1.00
R7044:Zfp451 UTSW 1 33802167 intron probably benign
R7071:Zfp451 UTSW 1 33776744 missense possibly damaging 0.96
R7082:Zfp451 UTSW 1 33772891 critical splice donor site probably null
R7123:Zfp451 UTSW 1 33776869 missense probably damaging 1.00
R7149:Zfp451 UTSW 1 33777324 missense probably damaging 1.00
R7179:Zfp451 UTSW 1 33802570 missense unknown
R7185:Zfp451 UTSW 1 33769893 missense probably damaging 1.00
R7228:Zfp451 UTSW 1 33803394 missense unknown
R7402:Zfp451 UTSW 1 33813762 missense probably benign
R7462:Zfp451 UTSW 1 33777013 missense probably damaging 1.00
R7488:Zfp451 UTSW 1 33779140 missense probably benign 0.22
R7507:Zfp451 UTSW 1 33769759 missense probably damaging 1.00
R7774:Zfp451 UTSW 1 33805393 missense probably benign 0.20
R7835:Zfp451 UTSW 1 33772979 missense probably damaging 1.00
R7979:Zfp451 UTSW 1 33782138 missense probably benign 0.01
R8123:Zfp451 UTSW 1 33762167 missense possibly damaging 0.92
R8137:Zfp451 UTSW 1 33782075 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- CTACCTTTCTCCAGCAGGAC -3'
(R):5'- AATCCCAGGAGTGTGTGAAG -3'

Sequencing Primer
(F):5'- CTGGAAGGCATCGGTCATAGTC -3'
(R):5'- GCACTGCATGTCCTTGACAAG -3'
Posted On2019-12-04