Incidental Mutation 'RF005:Olfr1039'
Institutional Source Beutler Lab
Gene Symbol Olfr1039
Ensembl Gene ENSMUSG00000075204
Gene Nameolfactory receptor 1039
SynonymsMOR185-5, MOR185-5, GA_x6K02T2Q125-47600809-47599850, MOR185-9P, Olfr1517, MOR185-5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #RF005 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location86127995-86135928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86131070 bp
Amino Acid Change Methionine to Valine at position 198 (M198V)
Ref Sequence ENSEMBL: ENSMUSP00000150584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099910] [ENSMUST00000214364] [ENSMUST00000216566] [ENSMUST00000216665]
Predicted Effect probably benign
Transcript: ENSMUST00000099910
AA Change: M198V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000097494
Gene: ENSMUSG00000075204
AA Change: M198V

Pfam:7tm_4 31 307 1e-50 PFAM
Pfam:7tm_1 41 290 2.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214364
AA Change: M198V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000216566
AA Change: M198V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000216665
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency 94% (65/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik CTGCTG CTGCTGTGGATGCTG 1: 82,913,585 probably benign Het
Abca1 G T 4: 53,049,125 T1651N probably damaging Het
Adamtsl3 A G 7: 82,612,395 T40A Het
Adgra3 A T 5: 50,013,387 probably null Het
Apcs A T 1: 172,894,242 M179K probably damaging Het
Baiap2 G A 11: 119,996,529 E217K possibly damaging Het
Ccdc69 A G 11: 55,060,523 L24P probably damaging Het
Cdh16 T G 8: 104,617,052 N604T probably damaging Het
Cfb C T 17: 34,858,046 V538I possibly damaging Het
Col6a3 A G 1: 90,811,262 S1022P probably benign Het
Cpeb1 A G 7: 81,361,806 L129S possibly damaging Het
Crybg1 A G 10: 44,004,745 V149A probably benign Het
Cyp4f16 C A 17: 32,545,195 probably null Het
Dlg5 G A 14: 24,158,493 Q882* probably null Het
Fsip2 T A 2: 82,992,532 I6203K probably benign Het
Gabre CCGGCT CCGGCTACGGCT X: 72,270,045 probably null Het
Gm17660 A C 5: 104,074,859 probably null Het
Gm9513 T C 9: 36,475,674 S13P possibly damaging Het
Gprc5d A T 6: 135,116,519 L130Q probably damaging Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Hmcn1 T A 1: 150,635,146 K3609* probably null Het
Hsdl2 GCTGCAG GCTGCAGCAGCAGCCACATCTGCAG 4: 59,610,652 probably benign Het
Kl A C 5: 150,953,420 Y235S probably benign Het
Map6d1 G A 16: 20,241,000 T105I probably benign Het
Mast4 GGTGGTGGTGG GGTGGTGGTGGTGGTGG 13: 102,736,307 probably benign Het
Mms22l A G 4: 24,517,207 I363V probably benign Het
Myo7a T C 7: 98,093,617 I391V probably benign Het
Nab2 A T 10: 127,664,364 D286E probably benign Het
Nrxn1 G A 17: 90,362,876 R1144C probably damaging Het
Olfr592 T C 7: 103,186,691 I30T possibly damaging Het
Olfr635 A G 7: 103,979,561 D123G probably damaging Het
Pan2 G A 10: 128,315,535 E842K probably benign Het
Prex2 A C 1: 11,185,166 D1145A possibly damaging Het
Prop1 A C 11: 50,951,130 Y150D possibly damaging Het
Psip1 T C 4: 83,460,498 I353M probably damaging Het
Rapgef1 C A 2: 29,707,195 probably null Het
Rgl1 G A 1: 152,521,363 S684L probably benign Het
Sbf2 T A 7: 110,317,008 D1552V probably damaging Het
Serpinh1 C T 7: 99,346,203 V391M probably damaging Het
Slc35e4 A T 11: 3,907,960 L215Q possibly damaging Het
Tbl3 TCTT TCTTCTT 17: 24,702,541 probably benign Het
Tex15 T A 8: 33,576,677 M2045K probably benign Het
Tmprss15 T C 16: 78,953,801 *1070W probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Het
Trav15-2-dv6-2 GGAG GGAGGAG 14: 53,649,751 probably benign Het
Trav15-2-dv6-2 GAA GAACAA 14: 53,649,754 probably benign Het
Trim33 GCCCCGGCCCCCG GCCCCG 3: 103,280,212 probably null Het
Tub C A 7: 109,022,639 Q95K probably benign Het
Uhrf1bp1 A T 17: 27,885,531 D517V probably damaging Het
Usp9y T A Y: 1,435,046 Q261L probably benign Het
Utp20 A T 10: 88,825,457 D29E probably damaging Het
Vill G A 9: 119,060,439 V148M probably damaging Het
Vmn2r120 C T 17: 57,521,991 E535K possibly damaging Het
Zfp451 A T 1: 33,776,792 Y692* probably null Het
Zfp599 A C 9: 22,253,884 V65G probably benign Het
Zfp808 T C 13: 62,171,299 V114A probably benign Het
Other mutations in Olfr1039
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Olfr1039 APN 2 86131668 utr 5 prime probably benign
IGL01981:Olfr1039 APN 2 86130830 missense probably benign 0.44
IGL02958:Olfr1039 APN 2 86131007 missense probably benign 0.00
R0645:Olfr1039 UTSW 2 86131034 missense probably damaging 1.00
R1052:Olfr1039 UTSW 2 86131571 missense probably benign 0.13
R1613:Olfr1039 UTSW 2 86131063 missense probably damaging 1.00
R2132:Olfr1039 UTSW 2 86131261 missense possibly damaging 0.52
R3956:Olfr1039 UTSW 2 86131019 missense probably benign
R6372:Olfr1039 UTSW 2 86130854 missense possibly damaging 0.50
R7338:Olfr1039 UTSW 2 86131382 missense probably damaging 0.99
R7514:Olfr1039 UTSW 2 86131628 missense probably damaging 1.00
R7535:Olfr1039 UTSW 2 86131264 missense probably benign 0.00
R7537:Olfr1039 UTSW 2 86131264 missense probably benign 0.00
R8052:Olfr1039 UTSW 2 86131377 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04