Incidental Mutation 'RF005:Mms22l'
ID602741
Institutional Source Beutler Lab
Gene Symbol Mms22l
Ensembl Gene ENSMUSG00000045751
Gene NameMMS22-like, DNA repair protein
SynonymsF730047E07Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF005 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location24496451-24602950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24517207 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 363 (I363V)
Ref Sequence ENSEMBL: ENSMUSP00000057715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050446] [ENSMUST00000108222] [ENSMUST00000172622]
Predicted Effect probably benign
Transcript: ENSMUST00000050446
AA Change: I363V

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000057715
Gene: ENSMUSG00000045751
AA Change: I363V

DomainStartEndE-ValueType
Pfam:MMS22L_N 26 395 1.1e-199 PFAM
Pfam:MMS22L_N 392 690 4.6e-155 PFAM
low complexity region 698 711 N/A INTRINSIC
low complexity region 761 770 N/A INTRINSIC
Pfam:MMS22L_C 809 1186 2.3e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108222
AA Change: I363V

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103857
Gene: ENSMUSG00000045751
AA Change: I363V

DomainStartEndE-ValueType
Pfam:MMS22L_N 26 730 N/A PFAM
low complexity region 738 751 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
Pfam:MMS22L_C 849 1225 1.4e-142 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000133800
Gene: ENSMUSG00000045751
AA Change: I91V

DomainStartEndE-ValueType
Pfam:MMS22L_N 1 459 1.3e-239 PFAM
low complexity region 467 480 N/A INTRINSIC
low complexity region 530 539 N/A INTRINSIC
Pfam:MMS22L_C 578 733 1.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172622
AA Change: I253V

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133658
Gene: ENSMUSG00000045751
AA Change: I253V

DomainStartEndE-ValueType
Pfam:MMS22L_N 1 204 2.5e-112 PFAM
Pfam:MMS22L_N 202 323 2.2e-61 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency 94% (65/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with tonsoku-like, DNA repair protein (TONSL), and this complex recognizes and repairs DNA double-strand breaks at sites of stalled or collapsed replication forks. The encoded protein also can bind with the histone-associated protein NFKBIL2 to help regulate the chromatin state at stalled replication forks. Finally, this gene appears to be overexpressed in most lung and esophageal cancers. Multiple transcript variants exist for this gene, but the full-length nature of only one has been determined to date. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null mutation die prenatally. Heterozygous mice exhibit defects in pinna responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,884 probably benign Het
A030005L19Rik CTGCTG CTGCTGTGGATGCTG 1: 82,913,585 probably benign Het
Abca1 G T 4: 53,049,125 T1651N probably damaging Het
Adamtsl3 A G 7: 82,612,395 T40A Het
Adgra3 A T 5: 50,013,387 probably null Het
Apcs A T 1: 172,894,242 M179K probably damaging Het
Baiap2 G A 11: 119,996,529 E217K possibly damaging Het
Ccdc69 A G 11: 55,060,523 L24P probably damaging Het
Cdh16 T G 8: 104,617,052 N604T probably damaging Het
Cfb C T 17: 34,858,046 V538I possibly damaging Het
Col6a3 A G 1: 90,811,262 S1022P probably benign Het
Cpeb1 A G 7: 81,361,806 L129S possibly damaging Het
Crybg1 A G 10: 44,004,745 V149A probably benign Het
Cyp4f16 C A 17: 32,545,195 probably null Het
Dlg5 G A 14: 24,158,493 Q882* probably null Het
Fsip2 T A 2: 82,992,532 I6203K probably benign Het
Gabre CCGGCT CCGGCTACGGCT X: 72,270,045 probably null Het
Gm17660 A C 5: 104,074,859 probably null Het
Gm9513 T C 9: 36,475,674 S13P possibly damaging Het
Gprc5d A T 6: 135,116,519 L130Q probably damaging Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Hmcn1 T A 1: 150,635,146 K3609* probably null Het
Hsdl2 GCTGCAG GCTGCAGCAGCAGCCACATCTGCAG 4: 59,610,652 probably benign Het
Kl A C 5: 150,953,420 Y235S probably benign Het
Map6d1 G A 16: 20,241,000 T105I probably benign Het
Mast4 GGTGGTGGTGG GGTGGTGGTGGTGGTGG 13: 102,736,307 probably benign Het
Mbd1 TGTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC TATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC 18: 74,273,573 probably benign Het
Myo7a T C 7: 98,093,617 I391V probably benign Het
Nab2 A T 10: 127,664,364 D286E probably benign Het
Nrxn1 G A 17: 90,362,876 R1144C probably damaging Het
Olfr1039 T C 2: 86,131,070 M198V probably benign Het
Olfr592 T C 7: 103,186,691 I30T possibly damaging Het
Olfr635 A G 7: 103,979,561 D123G probably damaging Het
Pan2 G A 10: 128,315,535 E842K probably benign Het
Prex2 A C 1: 11,185,166 D1145A possibly damaging Het
Prop1 A C 11: 50,951,130 Y150D possibly damaging Het
Prp2 AGGCCCACAGCAGCGACCCCCTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC AGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC 6: 132,600,501 probably benign Het
Psip1 T C 4: 83,460,498 I353M probably damaging Het
Rapgef1 C A 2: 29,707,195 probably null Het
Rgl1 G A 1: 152,521,363 S684L probably benign Het
Sbf2 T A 7: 110,317,008 D1552V probably damaging Het
Serpinh1 C T 7: 99,346,203 V391M probably damaging Het
Slc35e4 A T 11: 3,907,960 L215Q possibly damaging Het
Tbl3 TCTT TCTTCTT 17: 24,702,541 probably benign Het
Tex15 T A 8: 33,576,677 M2045K probably benign Het
Tmprss15 T C 16: 78,953,801 *1070W probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Het
Trav15-2-dv6-2 GGAG GGAGGAG 14: 53,649,751 probably benign Het
Trav15-2-dv6-2 GAA GAACAA 14: 53,649,754 probably benign Het
Trim33 GCCCCGGCCCCCG GCCCCG 3: 103,280,212 probably null Het
Triobp GACAA GACAACCCCAGGACTCCCTGTGCCCAACGGAACAA 15: 78,967,061 probably benign Het
Tub C A 7: 109,022,639 Q95K probably benign Het
Uhrf1bp1 A T 17: 27,885,531 D517V probably damaging Het
Usp9y T A Y: 1,435,046 Q261L probably benign Het
Utp20 A T 10: 88,825,457 D29E probably damaging Het
Vill G A 9: 119,060,439 V148M probably damaging Het
Vmn2r120 C T 17: 57,521,991 E535K possibly damaging Het
Zfp451 A T 1: 33,776,792 Y692* probably null Het
Zfp599 A C 9: 22,253,884 V65G probably benign Het
Zfp808 T C 13: 62,171,299 V114A probably benign Het
Znrd1as CACCACCACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCACCACCAC 17: 36,965,048 probably benign Het
Other mutations in Mms22l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01648:Mms22l APN 4 24502805 missense probably damaging 1.00
IGL02158:Mms22l APN 4 24505349 missense probably damaging 0.98
IGL02533:Mms22l APN 4 24581099 splice site probably benign
IGL02612:Mms22l APN 4 24508482 missense probably benign 0.03
IGL02685:Mms22l APN 4 24591133 missense probably benign
IGL03000:Mms22l APN 4 24581161 missense probably damaging 0.99
IGL03006:Mms22l APN 4 24521253 missense probably damaging 1.00
PIT4280001:Mms22l UTSW 4 24581149 missense probably benign 0.08
R0157:Mms22l UTSW 4 24588224 missense probably damaging 1.00
R0279:Mms22l UTSW 4 24497867 missense probably damaging 1.00
R0669:Mms22l UTSW 4 24517223 missense probably benign 0.00
R1056:Mms22l UTSW 4 24586344 critical splice donor site probably null
R1232:Mms22l UTSW 4 24536274 missense probably benign 0.24
R1389:Mms22l UTSW 4 24591076 missense probably damaging 1.00
R1543:Mms22l UTSW 4 24591084 missense probably benign 0.41
R1604:Mms22l UTSW 4 24502804 missense probably damaging 1.00
R1872:Mms22l UTSW 4 24598807 missense probably damaging 0.99
R1929:Mms22l UTSW 4 24535936 unclassified probably benign
R2024:Mms22l UTSW 4 24588365 missense probably damaging 1.00
R2081:Mms22l UTSW 4 24536150 missense probably damaging 1.00
R2104:Mms22l UTSW 4 24591084 missense probably benign 0.41
R2147:Mms22l UTSW 4 24580063 nonsense probably null
R2379:Mms22l UTSW 4 24496929 missense possibly damaging 0.87
R2496:Mms22l UTSW 4 24521269 missense probably benign 0.31
R3508:Mms22l UTSW 4 24586224 missense probably benign 0.01
R3625:Mms22l UTSW 4 24505357 missense probably damaging 1.00
R3789:Mms22l UTSW 4 24517115 missense possibly damaging 0.75
R4422:Mms22l UTSW 4 24503008 missense probably damaging 1.00
R4623:Mms22l UTSW 4 24502792 nonsense probably null
R4799:Mms22l UTSW 4 24580052 critical splice acceptor site probably null
R4825:Mms22l UTSW 4 24536226 missense probably damaging 1.00
R5236:Mms22l UTSW 4 24588347 missense probably benign 0.02
R5276:Mms22l UTSW 4 24578774 missense probably damaging 1.00
R5364:Mms22l UTSW 4 24496882 unclassified probably benign
R5394:Mms22l UTSW 4 24517115 missense possibly damaging 0.75
R6905:Mms22l UTSW 4 24503107 missense probably benign 0.00
R7206:Mms22l UTSW 4 24591146 missense probably benign 0.00
R7290:Mms22l UTSW 4 24517139 missense probably benign
R7425:Mms22l UTSW 4 24596287 missense probably benign 0.15
R7524:Mms22l UTSW 4 24536138 missense possibly damaging 0.89
R7536:Mms22l UTSW 4 24581240 missense probably damaging 0.99
R7722:Mms22l UTSW 4 24517201 missense probably damaging 1.00
R7757:Mms22l UTSW 4 24598884 critical splice donor site probably null
R7764:Mms22l UTSW 4 24598842 missense probably damaging 1.00
R7947:Mms22l UTSW 4 24505373 missense probably damaging 1.00
R8220:Mms22l UTSW 4 24536375 missense probably damaging 1.00
R8316:Mms22l UTSW 4 24578855 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGGGAAATACTTTAAGTCAAAGGTC -3'
(R):5'- GAGACACATGATTCCCCTTAGACAC -3'

Sequencing Primer
(F):5'- AAGTCAAAGGTCATTAGAATAGTGTC -3'
(R):5'- CTTTGGAGCAATGCAAACCATG -3'
Posted On2019-12-04