Incidental Mutation 'RF005:Abca1'
Institutional Source Beutler Lab
Gene Symbol Abca1
Ensembl Gene ENSMUSG00000015243
Gene NameATP-binding cassette, sub-family A (ABC1), member 1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF005 (G1)
Quality Score225.009
Status Validated
Chromosomal Location53030787-53159895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 53049125 bp
Amino Acid Change Threonine to Asparagine at position 1651 (T1651N)
Ref Sequence ENSEMBL: ENSMUSP00000030010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030010]
AlphaFold P41233
Predicted Effect probably damaging
Transcript: ENSMUST00000030010
AA Change: T1651N

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030010
Gene: ENSMUSG00000015243
AA Change: T1651N

transmembrane domain 25 47 N/A INTRINSIC
Pfam:ABC2_membrane_3 395 841 4.9e-14 PFAM
AAA 925 1122 4.2e-10 SMART
low complexity region 1137 1150 N/A INTRINSIC
Pfam:ABC2_membrane_3 1344 1869 1.7e-53 PFAM
low complexity region 1890 1899 N/A INTRINSIC
AAA 1938 2123 3.04e-7 SMART
low complexity region 2176 2187 N/A INTRINSIC
low complexity region 2222 2237 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency 94% (65/69)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Many homozygous null mutants die perinatally with placental defects. Survivors show altered steroidogenesis, defective lipid export in Golgi, low serum cholesterol, lipid accumulation in macrophages and lung, reduced fertility and kidney and heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik CTGCTG CTGCTGTGGATGCTG 1: 82,913,585 probably benign Het
Adamtsl3 A G 7: 82,612,395 T40A Het
Adgra3 A T 5: 50,013,387 probably null Het
Apcs A T 1: 172,894,242 M179K probably damaging Het
Baiap2 G A 11: 119,996,529 E217K possibly damaging Het
Ccdc69 A G 11: 55,060,523 L24P probably damaging Het
Cdh16 T G 8: 104,617,052 N604T probably damaging Het
Cfb C T 17: 34,858,046 V538I possibly damaging Het
Col6a3 A G 1: 90,811,262 S1022P probably benign Het
Cpeb1 A G 7: 81,361,806 L129S possibly damaging Het
Crybg1 A G 10: 44,004,745 V149A probably benign Het
Cyp4f16 C A 17: 32,545,195 probably null Het
Dlg5 G A 14: 24,158,493 Q882* probably null Het
Fsip2 T A 2: 82,992,532 I6203K probably benign Het
Gabre CCGGCT CCGGCTACGGCT X: 72,270,045 probably null Het
Gm17660 A C 5: 104,074,859 probably null Het
Gm9513 T C 9: 36,475,674 S13P possibly damaging Het
Gprc5d A T 6: 135,116,519 L130Q probably damaging Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Hmcn1 T A 1: 150,635,146 K3609* probably null Het
Hsdl2 GCTGCAG GCTGCAGCAGCAGCCACATCTGCAG 4: 59,610,652 probably benign Het
Kl A C 5: 150,953,420 Y235S probably benign Het
Map6d1 G A 16: 20,241,000 T105I probably benign Het
Mast4 GGTGGTGGTGG GGTGGTGGTGGTGGTGG 13: 102,736,307 probably benign Het
Mms22l A G 4: 24,517,207 I363V probably benign Het
Myo7a T C 7: 98,093,617 I391V probably benign Het
Nab2 A T 10: 127,664,364 D286E probably benign Het
Nrxn1 G A 17: 90,362,876 R1144C probably damaging Het
Olfr1039 T C 2: 86,131,070 M198V probably benign Het
Olfr592 T C 7: 103,186,691 I30T possibly damaging Het
Olfr635 A G 7: 103,979,561 D123G probably damaging Het
Pan2 G A 10: 128,315,535 E842K probably benign Het
Prex2 A C 1: 11,185,166 D1145A possibly damaging Het
Prop1 A C 11: 50,951,130 Y150D possibly damaging Het
Psip1 T C 4: 83,460,498 I353M probably damaging Het
Rapgef1 C A 2: 29,707,195 probably null Het
Rgl1 G A 1: 152,521,363 S684L probably benign Het
Sbf2 T A 7: 110,317,008 D1552V probably damaging Het
Serpinh1 C T 7: 99,346,203 V391M probably damaging Het
Slc35e4 A T 11: 3,907,960 L215Q possibly damaging Het
Tbl3 TCTT TCTTCTT 17: 24,702,541 probably benign Het
Tex15 T A 8: 33,576,677 M2045K probably benign Het
Tmprss15 T C 16: 78,953,801 *1070W probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Het
Trav15-2-dv6-2 GGAG GGAGGAG 14: 53,649,751 probably benign Het
Trav15-2-dv6-2 GAA GAACAA 14: 53,649,754 probably benign Het
Trim33 GCCCCGGCCCCCG GCCCCG 3: 103,280,212 probably null Het
Tub C A 7: 109,022,639 Q95K probably benign Het
Uhrf1bp1 A T 17: 27,885,531 D517V probably damaging Het
Usp9y T A Y: 1,435,046 Q261L probably benign Het
Utp20 A T 10: 88,825,457 D29E probably damaging Het
Vill G A 9: 119,060,439 V148M probably damaging Het
Vmn2r120 C T 17: 57,521,991 E535K possibly damaging Het
Zfp451 A T 1: 33,776,792 Y692* probably null Het
Zfp599 A C 9: 22,253,884 V65G probably benign Het
Zfp808 T C 13: 62,171,299 V114A probably benign Het
Other mutations in Abca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Abca1 APN 4 53059255 critical splice donor site probably null
IGL00778:Abca1 APN 4 53086132 missense probably benign
IGL01013:Abca1 APN 4 53038185 nonsense probably null
IGL01510:Abca1 APN 4 53143979 missense probably damaging 0.97
IGL01608:Abca1 APN 4 53038158 missense probably damaging 1.00
IGL01845:Abca1 APN 4 53090297 missense probably damaging 1.00
IGL02048:Abca1 APN 4 53069831 missense probably damaging 1.00
IGL02249:Abca1 APN 4 53068739 nonsense probably null
IGL02569:Abca1 APN 4 53034061 missense probably damaging 1.00
IGL02622:Abca1 APN 4 53034046 missense probably damaging 0.99
R6720_abca1_529 UTSW 4 53083733 missense probably damaging 1.00
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0050:Abca1 UTSW 4 53069910 splice site probably benign
R0107:Abca1 UTSW 4 53080834 missense probably benign 0.00
R0127:Abca1 UTSW 4 53067155 missense probably benign 0.00
R0178:Abca1 UTSW 4 53081953 missense possibly damaging 0.89
R0207:Abca1 UTSW 4 53086039 missense probably damaging 0.97
R0267:Abca1 UTSW 4 53046105 missense probably damaging 1.00
R0269:Abca1 UTSW 4 53044228 missense probably benign
R0586:Abca1 UTSW 4 53092860 missense probably benign 0.00
R0587:Abca1 UTSW 4 53107035 missense probably benign 0.00
R1403:Abca1 UTSW 4 53059253 splice site probably benign
R1404:Abca1 UTSW 4 53059253 splice site probably benign
R1405:Abca1 UTSW 4 53059253 splice site probably benign
R1558:Abca1 UTSW 4 53092887 missense probably null 0.00
R1655:Abca1 UTSW 4 53050964 missense probably benign
R1662:Abca1 UTSW 4 53090251 splice site probably null
R1769:Abca1 UTSW 4 53074325 missense probably damaging 1.00
R1898:Abca1 UTSW 4 53071977 missense probably benign 0.08
R1945:Abca1 UTSW 4 53061509 frame shift probably null
R1966:Abca1 UTSW 4 53050409 missense probably damaging 1.00
R2055:Abca1 UTSW 4 53069881 missense probably benign
R2185:Abca1 UTSW 4 53089830 missense probably benign 0.12
R2202:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2203:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2204:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R3056:Abca1 UTSW 4 53127626 missense probably benign
R3849:Abca1 UTSW 4 53061481 splice site probably benign
R3850:Abca1 UTSW 4 53061481 splice site probably benign
R3906:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R3908:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R4050:Abca1 UTSW 4 53044144 missense probably damaging 1.00
R4204:Abca1 UTSW 4 53090369 missense probably benign 0.00
R4225:Abca1 UTSW 4 53085106 missense possibly damaging 0.87
R4577:Abca1 UTSW 4 53062568 missense possibly damaging 0.94
R4979:Abca1 UTSW 4 53085092 splice site probably null
R5022:Abca1 UTSW 4 53041570 frame shift probably null
R5168:Abca1 UTSW 4 53086070 missense probably benign
R5363:Abca1 UTSW 4 53132963 missense probably benign 0.00
R5439:Abca1 UTSW 4 53042381 missense possibly damaging 0.55
R5604:Abca1 UTSW 4 53067168 splice site probably null
R5614:Abca1 UTSW 4 53046132 missense probably damaging 1.00
R5810:Abca1 UTSW 4 53079631 missense probably benign
R6001:Abca1 UTSW 4 53075555 missense possibly damaging 0.68
R6151:Abca1 UTSW 4 53085261 missense probably benign
R6185:Abca1 UTSW 4 53078089 missense probably benign 0.31
R6262:Abca1 UTSW 4 53092917 missense probably benign 0.01
R6455:Abca1 UTSW 4 53042376 missense probably damaging 0.98
R6472:Abca1 UTSW 4 53085991 critical splice donor site probably null
R6564:Abca1 UTSW 4 53034031 missense possibly damaging 0.85
R6720:Abca1 UTSW 4 53083733 missense probably damaging 1.00
R6903:Abca1 UTSW 4 53143952 missense probably benign 0.17
R6960:Abca1 UTSW 4 53072924 missense probably benign 0.00
R7065:Abca1 UTSW 4 53074233 missense probably damaging 0.98
R7142:Abca1 UTSW 4 53082050 missense probably damaging 1.00
R7322:Abca1 UTSW 4 53067151 missense probably damaging 0.97
R7520:Abca1 UTSW 4 53078114 missense probably benign
R7547:Abca1 UTSW 4 53109269 missense probably benign 0.02
R7793:Abca1 UTSW 4 53042367 missense not run
R7863:Abca1 UTSW 4 53107179 missense probably benign
R7877:Abca1 UTSW 4 53046135 missense possibly damaging 0.55
R8010:Abca1 UTSW 4 53127600 missense probably benign
R8058:Abca1 UTSW 4 53081954 missense possibly damaging 0.60
R8181:Abca1 UTSW 4 53059303 missense probably benign 0.21
R8471:Abca1 UTSW 4 53044187 missense probably damaging 1.00
R8774:Abca1 UTSW 4 53090358 missense possibly damaging 0.89
R8774-TAIL:Abca1 UTSW 4 53090358 missense possibly damaging 0.89
R8806:Abca1 UTSW 4 53084520 missense probably benign 0.17
R9081:Abca1 UTSW 4 53109162 critical splice donor site probably null
RF024:Abca1 UTSW 4 53049125 missense probably damaging 0.97
X0023:Abca1 UTSW 4 53049038 missense possibly damaging 0.91
Z1177:Abca1 UTSW 4 53079584 missense probably benign 0.00
Z1177:Abca1 UTSW 4 53080799 missense probably benign 0.01
Z1177:Abca1 UTSW 4 53086133 missense possibly damaging 0.73
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04