Incidental Mutation 'RF005:Prp2'
ID602748
Institutional Source Beutler Lab
Gene Symbol Prp2
Ensembl Gene ENSMUSG00000058295
Gene Nameproline rich protein 2
SynonymsMP14
Accession Numbers
Is this an essential gene? Not available question?
Stock #RF005 (G1)
Quality Score217.468
Status Not validated
Chromosome6
Chromosomal Location132595913-132601236 bp(+) (GRCm38)
Type of Mutationsmall deletion (14 aa in frame mutation)
DNA Base Change (assembly) AGGCCCACAGCAGCGACCCCCTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC to AGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC at 132600501 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076061] [ENSMUST00000178961]
Predicted Effect probably benign
Transcript: ENSMUST00000076061
SMART Domains Protein: ENSMUSP00000075435
Gene: ENSMUSG00000058295

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 24 44 N/A INTRINSIC
low complexity region 49 299 N/A INTRINSIC
low complexity region 302 316 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178961
SMART Domains Protein: ENSMUSP00000135942
Gene: ENSMUSG00000058295

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 24 44 N/A INTRINSIC
low complexity region 49 299 N/A INTRINSIC
low complexity region 302 316 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency 94% (65/69)
MGI Phenotype FUNCTION: This gene encodes a member of the heterogeneous family of proline-rich salivary glycoproteins. The expression of this gene is dramatically induced in the parotid and submandibular glands of mice by beta-adrenergic stimulation. The encoded protein serves an important dental function by protecting mice against toxic dietary polyphenols such as tannins and influence the visco-elastic properties of the mucus. This gene is located in a cluster of closely related salivary proline-rich proteins on chromosome 6. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,884 probably benign Het
A030005L19Rik CTGCTG CTGCTGTGGATGCTG 1: 82,913,585 probably benign Het
Abca1 G T 4: 53,049,125 T1651N probably damaging Het
Adamtsl3 A G 7: 82,612,395 T40A Het
Adgra3 A T 5: 50,013,387 probably null Het
Apcs A T 1: 172,894,242 M179K probably damaging Het
Baiap2 G A 11: 119,996,529 E217K possibly damaging Het
Ccdc69 A G 11: 55,060,523 L24P probably damaging Het
Cdh16 T G 8: 104,617,052 N604T probably damaging Het
Cfb C T 17: 34,858,046 V538I possibly damaging Het
Col6a3 A G 1: 90,811,262 S1022P probably benign Het
Cpeb1 A G 7: 81,361,806 L129S possibly damaging Het
Crybg1 A G 10: 44,004,745 V149A probably benign Het
Cyp4f16 C A 17: 32,545,195 probably null Het
Dlg5 G A 14: 24,158,493 Q882* probably null Het
Fsip2 T A 2: 82,992,532 I6203K probably benign Het
Gabre CCGGCT CCGGCTACGGCT X: 72,270,045 probably null Het
Gm17660 A C 5: 104,074,859 probably null Het
Gm9513 T C 9: 36,475,674 S13P possibly damaging Het
Gprc5d A T 6: 135,116,519 L130Q probably damaging Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Hmcn1 T A 1: 150,635,146 K3609* probably null Het
Hsdl2 GCTGCAG GCTGCAGCAGCAGCCACATCTGCAG 4: 59,610,652 probably benign Het
Kl A C 5: 150,953,420 Y235S probably benign Het
Map6d1 G A 16: 20,241,000 T105I probably benign Het
Mast4 GGTGGTGGTGG GGTGGTGGTGGTGGTGG 13: 102,736,307 probably benign Het
Mbd1 TGTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC TATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC 18: 74,273,573 probably benign Het
Mms22l A G 4: 24,517,207 I363V probably benign Het
Myo7a T C 7: 98,093,617 I391V probably benign Het
Nab2 A T 10: 127,664,364 D286E probably benign Het
Nrxn1 G A 17: 90,362,876 R1144C probably damaging Het
Olfr1039 T C 2: 86,131,070 M198V probably benign Het
Olfr592 T C 7: 103,186,691 I30T possibly damaging Het
Olfr635 A G 7: 103,979,561 D123G probably damaging Het
Pan2 G A 10: 128,315,535 E842K probably benign Het
Prex2 A C 1: 11,185,166 D1145A possibly damaging Het
Prop1 A C 11: 50,951,130 Y150D possibly damaging Het
Psip1 T C 4: 83,460,498 I353M probably damaging Het
Rapgef1 C A 2: 29,707,195 probably null Het
Rgl1 G A 1: 152,521,363 S684L probably benign Het
Sbf2 T A 7: 110,317,008 D1552V probably damaging Het
Serpinh1 C T 7: 99,346,203 V391M probably damaging Het
Slc35e4 A T 11: 3,907,960 L215Q possibly damaging Het
Tbl3 TCTT TCTTCTT 17: 24,702,541 probably benign Het
Tex15 T A 8: 33,576,677 M2045K probably benign Het
Tmprss15 T C 16: 78,953,801 *1070W probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Het
Trav15-2-dv6-2 GGAG GGAGGAG 14: 53,649,751 probably benign Het
Trav15-2-dv6-2 GAA GAACAA 14: 53,649,754 probably benign Het
Trim33 GCCCCGGCCCCCG GCCCCG 3: 103,280,212 probably null Het
Triobp GACAA GACAACCCCAGGACTCCCTGTGCCCAACGGAACAA 15: 78,967,061 probably benign Het
Tub C A 7: 109,022,639 Q95K probably benign Het
Uhrf1bp1 A T 17: 27,885,531 D517V probably damaging Het
Usp9y T A Y: 1,435,046 Q261L probably benign Het
Utp20 A T 10: 88,825,457 D29E probably damaging Het
Vill G A 9: 119,060,439 V148M probably damaging Het
Vmn2r120 C T 17: 57,521,991 E535K possibly damaging Het
Zfp451 A T 1: 33,776,792 Y692* probably null Het
Zfp599 A C 9: 22,253,884 V65G probably benign Het
Zfp808 T C 13: 62,171,299 V114A probably benign Het
Znrd1as CACCACCACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCACCACCAC 17: 36,965,048 probably benign Het
Other mutations in Prp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Prp2 APN 6 132599878 missense unknown
IGL02951:Prp2 APN 6 132599825 missense unknown
PIT4458001:Prp2 UTSW 6 132600547 missense unknown
R2034:Prp2 UTSW 6 132595984 splice site probably null
R2432:Prp2 UTSW 6 132599911 missense unknown
R5283:Prp2 UTSW 6 132600643 missense unknown
R7761:Prp2 UTSW 6 132600343 nonsense probably null
R7877:Prp2 UTSW 6 132595965 missense unknown
R8033:Prp2 UTSW 6 132600428 missense unknown
R8062:Prp2 UTSW 6 132600688 missense unknown
RF016:Prp2 UTSW 6 132600512 small deletion probably benign
RF039:Prp2 UTSW 6 132600501 small deletion probably benign
RF052:Prp2 UTSW 6 132600512 small deletion probably benign
RF054:Prp2 UTSW 6 132600521 frame shift probably null
RF057:Prp2 UTSW 6 132600530 frame shift probably null
X0053:Prp2 UTSW 6 132600596 missense unknown
Z1176:Prp2 UTSW 6 132600237 missense unknown
Z1177:Prp2 UTSW 6 132595970 missense unknown
Predicted Primers PCR Primer
(F):5'- CGCCTGTTAATGGGAGCCAG -3'
(R):5'- GCCTTGTGGGTTTCCAGCC -3'

Sequencing Primer
(F):5'- AGGTCCACAGCCGAGAC -3'
(R):5'- TTTCCAGCCAGAGGAGGTG -3'
Posted On2019-12-04