Incidental Mutation 'RF005:Cpeb1'
ID602750
Institutional Source Beutler Lab
Gene Symbol Cpeb1
Ensembl Gene ENSMUSG00000025586
Gene Namecytoplasmic polyadenylation element binding protein 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF005 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location81347026-81455465 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81361806 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 129 (L129S)
Ref Sequence ENSEMBL: ENSMUSP00000137079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098331] [ENSMUST00000130310] [ENSMUST00000178892]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098331
AA Change: L128S

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095936
Gene: ENSMUSG00000025586
AA Change: L128S

DomainStartEndE-ValueType
low complexity region 112 126 N/A INTRINSIC
low complexity region 176 195 N/A INTRINSIC
RRM 311 386 2.6e-4 SMART
RRM_2 430 506 2.7e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000130310
AA Change: L123S

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120139
Gene: ENSMUSG00000025586
AA Change: L123S

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
low complexity region 171 190 N/A INTRINSIC
RRM 306 376 1.35e-1 SMART
RRM 420 496 6.36e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000178892
AA Change: L129S

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137079
Gene: ENSMUSG00000025586
AA Change: L129S

DomainStartEndE-ValueType
Pfam:CEBP1_N 1 307 2.5e-153 PFAM
RRM 312 387 6.25e-2 SMART
RRM 431 507 6.36e-1 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytoplasmic polyadenylation element binding protein family. This highly conserved protein binds to a specific RNA sequence, called the cytoplasmic polyadenylation element, found in the 3' untranslated region of some mRNAs. The encoded protein functions in both the cytoplasm and the nucleus. It is involved in the regulation of mRNA translation, as well as processing of the 3' untranslated region, and may play a role in cell proliferation and tumorigenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null allele are viable and overtly normal but display a developmental arrest of both female and male germ cells at the pachytene stage, defective synaptonemal complex formation, and impaired neuronal synaptic plasticity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,884 probably benign Het
A030005L19Rik CTGCTG CTGCTGTGGATGCTG 1: 82,913,585 probably benign Het
Abca1 G T 4: 53,049,125 T1651N probably damaging Het
Adamtsl3 A G 7: 82,612,395 T40A Het
Apcs A T 1: 172,894,242 M179K probably damaging Het
Baiap2 G A 11: 119,996,529 E217K possibly damaging Het
Cacna1f GGA GGACGA X: 7,620,059 probably benign Het
Ccdc69 A G 11: 55,060,523 L24P probably damaging Het
Cdh16 T G 8: 104,617,052 N604T probably damaging Het
Cfb C T 17: 34,858,046 V538I possibly damaging Het
Col6a3 A G 1: 90,811,262 S1022P probably benign Het
Crybg1 A G 10: 44,004,745 V149A probably benign Het
Dlg5 G A 14: 24,158,493 Q882* probably null Het
Fam171b GCAGCA GCAGCATCAGCA 2: 83,812,880 probably benign Het
Fsip2 T A 2: 82,992,532 I6203K probably benign Het
Gab3 CTT CTTATT X: 74,999,985 probably null Het
Gabre CCGGCT CCGGCTACGGCT X: 72,270,045 probably null Het
Gm17660 A C 5: 104,074,859 probably null Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,748 probably benign Het
Gm9513 T C 9: 36,475,674 S13P possibly damaging Het
Gprc5d A T 6: 135,116,519 L130Q probably damaging Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Hmcn1 T A 1: 150,635,146 K3609* probably null Het
Hsdl2 GCTGCAG GCTGCAGCAGCAGCCACATCTGCAG 4: 59,610,652 probably benign Het
Kl A C 5: 150,953,420 Y235S probably benign Het
Lypd8 ACCAA ACCAAGCACCAACAGTTCCCTCGCCTCCGTTACCCCCCCAA 11: 58,390,231 probably benign Het
Map6d1 G A 16: 20,241,000 T105I probably benign Het
Mast4 GGTGGTGGTGG GGTGGTGGTGGTGGTGG 13: 102,736,307 probably benign Het
Mbd1 TGTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC TATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC 18: 74,273,573 probably benign Het
Mms22l A G 4: 24,517,207 I363V probably benign Het
Morn4 GTCAGGCAGTGA GTCAGGCAGTGACTCAGGCAGTGA 19: 42,076,106 probably null Het
Myo7a T C 7: 98,093,617 I391V probably benign Het
Nab2 A T 10: 127,664,364 D286E probably benign Het
Nrxn1 G A 17: 90,362,876 R1144C probably damaging Het
Nusap1 GCAGTGAGGAGCAAGCTGAGA GCAGTGAGGAGCAAGCTGAGATACACGTTACCAGTGAGGAGCAAGCTGAGA 2: 119,627,590 probably benign Het
Nusap1 AGCTGAGA AGCTGAGATACACGTTAGCAGTGAGGAGCACGCTGAGA 2: 119,627,603 probably benign Het
Olfr1039 T C 2: 86,131,070 M198V probably benign Het
Olfr592 T C 7: 103,186,691 I30T possibly damaging Het
Olfr624 CAAA CCAAAA 7: 103,670,785 probably null Het
Olfr635 A G 7: 103,979,561 D123G probably damaging Het
Pan2 G A 10: 128,315,535 E842K probably benign Het
Prex2 A C 1: 11,185,166 D1145A possibly damaging Het
Prop1 A C 11: 50,951,130 Y150D possibly damaging Het
Prp2 AGGCCCACAGCAGCGACCCCCTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC AGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC 6: 132,600,501 probably benign Het
Psip1 T C 4: 83,460,498 I353M probably damaging Het
Rfx4 T TCTCTCTCTCTCTCTCC 10: 84,858,494 probably benign Het
Rgl1 G A 1: 152,521,363 S684L probably benign Het
Rpgrip1 GGA GGAAGA 14: 52,149,391 probably benign Het
Sbf2 T A 7: 110,317,008 D1552V probably damaging Het
Serpinh1 C T 7: 99,346,203 V391M probably damaging Het
Slc35e4 A T 11: 3,907,960 L215Q possibly damaging Het
Tbl3 TCTT TCTTCTT 17: 24,702,541 probably benign Het
Tcof1 AGATGGGCCCTTTCCCAGAGATCCCCTT AGATGGGCCCTTTCCCAGAGATCCCCTTTGCTGCTGCGATGGGCCCTTTCCCAGAGATCCCCTT 18: 60,833,554 probably benign Het
Tex15 T A 8: 33,576,677 M2045K probably benign Het
Tfeb AGC AGCGGC 17: 47,786,105 probably benign Het
Tmprss15 T C 16: 78,953,801 *1070W probably null Het
Trappc9 CTGCTGCTGCTGCTGCTGCTGCTGCTGCTG CTGCTGCTGCTGCTGATGCTGCTGCTGCTGCTGCTGCTGCTGCTG 15: 72,801,300 probably benign Het
Trappc9 TGCTGCTGCTGCTGC TGCTGCTGCTGCTGCCGCTGCTGCTGCTGC 15: 72,801,310 probably benign Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Het
Trav15-2-dv6-2 GGAG GGAGGAG 14: 53,649,751 probably benign Het
Trav15-2-dv6-2 GAA GAACAA 14: 53,649,754 probably benign Het
Trim33 GCCCCGGCCCCCG GCCCCG 3: 103,280,212 probably null Het
Triobp GACAA GACAACCCCAGGACTCCCTGTGCCCAACGGAACAA 15: 78,967,061 probably benign Het
Tub C A 7: 109,022,639 Q95K probably benign Het
Uhrf1bp1 A T 17: 27,885,531 D517V probably damaging Het
Usp9y T A Y: 1,435,046 Q261L probably benign Het
Utp20 A T 10: 88,825,457 D29E probably damaging Het
Vill G A 9: 119,060,439 V148M probably damaging Het
Vmn2r120 C T 17: 57,521,991 E535K possibly damaging Het
Zfp451 A T 1: 33,776,792 Y692* probably null Het
Zfp598 A ACCACG 17: 24,680,794 probably null Het
Zfp599 A C 9: 22,253,884 V65G probably benign Het
Zfp808 T C 13: 62,171,299 V114A probably benign Het
Znrd1as CACCACCACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCACCACCAC 17: 36,965,048 probably benign Het
Other mutations in Cpeb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Cpeb1 APN 7 81372181 missense probably benign
IGL01598:Cpeb1 APN 7 81361801 missense probably benign
IGL02214:Cpeb1 APN 7 81372057 missense possibly damaging 0.89
IGL02527:Cpeb1 APN 7 81359887 missense probably damaging 1.00
IGL02878:Cpeb1 APN 7 81357326 missense probably damaging 1.00
IGL03065:Cpeb1 APN 7 81436290 missense probably benign 0.39
IGL03305:Cpeb1 APN 7 81361716 missense probably benign 0.16
PIT4458001:Cpeb1 UTSW 7 81348432 missense probably damaging 1.00
R0391:Cpeb1 UTSW 7 81361725 missense possibly damaging 0.89
R0711:Cpeb1 UTSW 7 81351870 missense probably benign 0.01
R1626:Cpeb1 UTSW 7 81436247 missense probably damaging 1.00
R1723:Cpeb1 UTSW 7 81436226 missense probably benign 0.29
R1902:Cpeb1 UTSW 7 81372119 missense probably benign 0.03
R4614:Cpeb1 UTSW 7 81436270 missense possibly damaging 0.46
R4773:Cpeb1 UTSW 7 81355947 missense probably benign
R5256:Cpeb1 UTSW 7 81351839 missense probably damaging 1.00
R5750:Cpeb1 UTSW 7 81436351 missense probably benign 0.01
R5927:Cpeb1 UTSW 7 81361680 missense possibly damaging 0.69
R6000:Cpeb1 UTSW 7 81361680 missense possibly damaging 0.69
R6526:Cpeb1 UTSW 7 81361669 missense probably benign
X0067:Cpeb1 UTSW 7 81359727 critical splice donor site probably null
Z1176:Cpeb1 UTSW 7 81359728 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGAAGCCACTCGTGTCTGAG -3'
(R):5'- CTTCTAACGAGGACTGAGTGAC -3'

Sequencing Primer
(F):5'- CACTCGTGTCTGAGTCAGAG -3'
(R):5'- AGGACTGAGTGACCAGCTTTC -3'
Posted On2019-12-04