Incidental Mutation 'RF005:Pan2'
ID602768
Institutional Source Beutler Lab
Gene Symbol Pan2
Ensembl Gene ENSMUSG00000005682
Gene NamePAN2 poly(A) specific ribonuclease subunit
SynonymsUsp52, 1200014O24Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF005 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location128303335-128321358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128315535 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 842 (E842K)
Ref Sequence ENSEMBL: ENSMUSP00000005825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005825] [ENSMUST00000218315] [ENSMUST00000219721]
Predicted Effect probably benign
Transcript: ENSMUST00000005825
AA Change: E842K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000005825
Gene: ENSMUSG00000005682
AA Change: E842K

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
SCOP:d1tbga_ 151 357 4e-11 SMART
Blast:WD40 225 271 4e-11 BLAST
low complexity region 412 425 N/A INTRINSIC
Pfam:UCH 515 920 2.6e-15 PFAM
Pfam:UCH_1 516 897 9.7e-70 PFAM
low complexity region 938 949 N/A INTRINSIC
EXOIII 972 1155 1.68e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218315
AA Change: E833K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000219721
AA Change: E815K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency 94% (65/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deadenylase that functions as the catalytic subunit of the polyadenylate binding protein dependent poly(A) nuclease complex. The encoded protein is a magnesium dependent 3' to 5' exoribonuclease that is involved in the degradation of cytoplasmic mRNAs. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,884 probably benign Het
A030005L19Rik CTGCTG CTGCTGTGGATGCTG 1: 82,913,585 probably benign Het
Abca1 G T 4: 53,049,125 T1651N probably damaging Het
Adamtsl3 A G 7: 82,612,395 T40A Het
Adgra3 A T 5: 50,013,387 probably null Het
Apcs A T 1: 172,894,242 M179K probably damaging Het
Baiap2 G A 11: 119,996,529 E217K possibly damaging Het
Ccdc69 A G 11: 55,060,523 L24P probably damaging Het
Cdh16 T G 8: 104,617,052 N604T probably damaging Het
Cfb C T 17: 34,858,046 V538I possibly damaging Het
Col6a3 A G 1: 90,811,262 S1022P probably benign Het
Cpeb1 A G 7: 81,361,806 L129S possibly damaging Het
Crybg1 A G 10: 44,004,745 V149A probably benign Het
Cyp4f16 C A 17: 32,545,195 probably null Het
Dlg5 G A 14: 24,158,493 Q882* probably null Het
Fsip2 T A 2: 82,992,532 I6203K probably benign Het
Gabre CCGGCT CCGGCTACGGCT X: 72,270,045 probably null Het
Gm17660 A C 5: 104,074,859 probably null Het
Gm9513 T C 9: 36,475,674 S13P possibly damaging Het
Gprc5d A T 6: 135,116,519 L130Q probably damaging Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Hmcn1 T A 1: 150,635,146 K3609* probably null Het
Hsdl2 GCTGCAG GCTGCAGCAGCAGCCACATCTGCAG 4: 59,610,652 probably benign Het
Kl A C 5: 150,953,420 Y235S probably benign Het
Map6d1 G A 16: 20,241,000 T105I probably benign Het
Mast4 GGTGGTGGTGG GGTGGTGGTGGTGGTGG 13: 102,736,307 probably benign Het
Mbd1 TGTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC TATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC 18: 74,273,573 probably benign Het
Mms22l A G 4: 24,517,207 I363V probably benign Het
Myo7a T C 7: 98,093,617 I391V probably benign Het
Nab2 A T 10: 127,664,364 D286E probably benign Het
Nrxn1 G A 17: 90,362,876 R1144C probably damaging Het
Olfr1039 T C 2: 86,131,070 M198V probably benign Het
Olfr592 T C 7: 103,186,691 I30T possibly damaging Het
Olfr635 A G 7: 103,979,561 D123G probably damaging Het
Prex2 A C 1: 11,185,166 D1145A possibly damaging Het
Prop1 A C 11: 50,951,130 Y150D possibly damaging Het
Prp2 AGGCCCACAGCAGCGACCCCCTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC AGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC 6: 132,600,501 probably benign Het
Psip1 T C 4: 83,460,498 I353M probably damaging Het
Rapgef1 C A 2: 29,707,195 probably null Het
Rgl1 G A 1: 152,521,363 S684L probably benign Het
Sbf2 T A 7: 110,317,008 D1552V probably damaging Het
Serpinh1 C T 7: 99,346,203 V391M probably damaging Het
Slc35e4 A T 11: 3,907,960 L215Q possibly damaging Het
Tbl3 TCTT TCTTCTT 17: 24,702,541 probably benign Het
Tex15 T A 8: 33,576,677 M2045K probably benign Het
Tmprss15 T C 16: 78,953,801 *1070W probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Het
Trav15-2-dv6-2 GGAG GGAGGAG 14: 53,649,751 probably benign Het
Trav15-2-dv6-2 GAA GAACAA 14: 53,649,754 probably benign Het
Trim33 GCCCCGGCCCCCG GCCCCG 3: 103,280,212 probably null Het
Triobp GACAA GACAACCCCAGGACTCCCTGTGCCCAACGGAACAA 15: 78,967,061 probably benign Het
Tub C A 7: 109,022,639 Q95K probably benign Het
Uhrf1bp1 A T 17: 27,885,531 D517V probably damaging Het
Usp9y T A Y: 1,435,046 Q261L probably benign Het
Utp20 A T 10: 88,825,457 D29E probably damaging Het
Vill G A 9: 119,060,439 V148M probably damaging Het
Vmn2r120 C T 17: 57,521,991 E535K possibly damaging Het
Zfp451 A T 1: 33,776,792 Y692* probably null Het
Zfp599 A C 9: 22,253,884 V65G probably benign Het
Zfp808 T C 13: 62,171,299 V114A probably benign Het
Znrd1as CACCACCACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCACCACCAC 17: 36,965,048 probably benign Het
Other mutations in Pan2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Pan2 APN 10 128312926 nonsense probably null
IGL02183:Pan2 APN 10 128309075 missense possibly damaging 0.74
IGL02219:Pan2 APN 10 128320352 missense probably benign 0.04
IGL02514:Pan2 APN 10 128310741 missense possibly damaging 0.94
IGL02552:Pan2 APN 10 128319027 missense probably damaging 1.00
IGL02623:Pan2 APN 10 128312899 missense probably benign
IGL02860:Pan2 APN 10 128310735 nonsense probably null
IGL03104:Pan2 APN 10 128315663 splice site probably benign
IGL03372:Pan2 APN 10 128315127 missense probably benign 0.09
R0541:Pan2 UTSW 10 128308222 missense possibly damaging 0.87
R0585:Pan2 UTSW 10 128310515 critical splice donor site probably null
R1079:Pan2 UTSW 10 128318238 missense probably damaging 0.99
R1650:Pan2 UTSW 10 128317899 missense probably damaging 1.00
R1847:Pan2 UTSW 10 128304378 missense possibly damaging 0.71
R1867:Pan2 UTSW 10 128313181 missense probably damaging 1.00
R1903:Pan2 UTSW 10 128308368 missense probably damaging 0.98
R1975:Pan2 UTSW 10 128320413 missense probably damaging 0.99
R1976:Pan2 UTSW 10 128320413 missense probably damaging 0.99
R1977:Pan2 UTSW 10 128320413 missense probably damaging 0.99
R2136:Pan2 UTSW 10 128313637 missense possibly damaging 0.95
R2162:Pan2 UTSW 10 128304222 missense possibly damaging 0.90
R2512:Pan2 UTSW 10 128304457 missense probably damaging 1.00
R2566:Pan2 UTSW 10 128313897 missense probably damaging 1.00
R2900:Pan2 UTSW 10 128308342 missense probably benign
R3957:Pan2 UTSW 10 128315177 missense probably damaging 0.99
R4571:Pan2 UTSW 10 128308643 missense probably benign 0.05
R5112:Pan2 UTSW 10 128315595 nonsense probably null
R5120:Pan2 UTSW 10 128314995 critical splice donor site probably null
R5183:Pan2 UTSW 10 128317969 missense probably damaging 1.00
R5325:Pan2 UTSW 10 128317634 missense possibly damaging 0.59
R5539:Pan2 UTSW 10 128308133 missense probably benign 0.16
R5642:Pan2 UTSW 10 128308100 missense probably benign 0.00
R5740:Pan2 UTSW 10 128308164 missense probably damaging 1.00
R5822:Pan2 UTSW 10 128320380 missense probably damaging 1.00
R6766:Pan2 UTSW 10 128314512 missense possibly damaging 0.79
R6902:Pan2 UTSW 10 128315637 missense probably benign 0.33
R6946:Pan2 UTSW 10 128315637 missense probably benign 0.33
R7206:Pan2 UTSW 10 128314545 nonsense probably null
R7490:Pan2 UTSW 10 128308440 missense probably benign 0.00
R7715:Pan2 UTSW 10 128317723 missense probably benign 0.00
R7794:Pan2 UTSW 10 128316527 splice site probably null
R8286:Pan2 UTSW 10 128318320 missense probably damaging 1.00
RF024:Pan2 UTSW 10 128315535 missense probably benign 0.00
Z1177:Pan2 UTSW 10 128304410 missense possibly damaging 0.94
Z1177:Pan2 UTSW 10 128314499 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAAACGTACGCTTACCAGTTCTG -3'
(R):5'- AGTGAGAGCTATCTGTCTCCTGG -3'

Sequencing Primer
(F):5'- ACGCTTACCAGTTCTGGGGTTG -3'
(R):5'- AGGAGCTCGGGGACAGC -3'
Posted On2019-12-04