Incidental Mutation 'RF005:Prop1'
ID602770
Institutional Source Beutler Lab
Gene Symbol Prop1
Ensembl Gene ENSMUSG00000044542
Gene Namepaired like homeodomain factor 1
SynonymsProp-1, prophet of Pit1, prophet of Pit-1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.680) question?
Stock #RF005 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location50950806-50953765 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 50951130 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 150 (Y150D)
Ref Sequence ENSEMBL: ENSMUSP00000057231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051159] [ENSMUST00000162420]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051159
AA Change: Y150D

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000057231
Gene: ENSMUSG00000044542
AA Change: Y150D

DomainStartEndE-ValueType
HOX 66 128 4.85e-25 SMART
low complexity region 150 168 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162420
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency 94% (65/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a paired-like homeodomain transcription factor in the developing pituitary gland. Expression occurs prior to and is required for expression of pou domain transcription factor 1, which is responsible for pituitary development and hormone expression. Mutations in this gene have been associated with combined pituitary hormone deficiency-2 as well as deficiencies in luteinizing hormone, follicle-stimulating hormone, growth hormone, prolactin, and thyroid-stimulating hormone. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit severe proportional dwarfism, hypothyroidism, and sterility. Mutants fail to develop the anterior pituitary cells that secrete growth hormone, prolactin, and thyroid stimulating hormone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,884 probably benign Het
A030005L19Rik CTGCTG CTGCTGTGGATGCTG 1: 82,913,585 probably benign Het
Abca1 G T 4: 53,049,125 T1651N probably damaging Het
Adamtsl3 A G 7: 82,612,395 T40A Het
Adgra3 A T 5: 50,013,387 probably null Het
Apcs A T 1: 172,894,242 M179K probably damaging Het
Baiap2 G A 11: 119,996,529 E217K possibly damaging Het
Ccdc69 A G 11: 55,060,523 L24P probably damaging Het
Cdh16 T G 8: 104,617,052 N604T probably damaging Het
Cfb C T 17: 34,858,046 V538I possibly damaging Het
Col6a3 A G 1: 90,811,262 S1022P probably benign Het
Cpeb1 A G 7: 81,361,806 L129S possibly damaging Het
Crybg1 A G 10: 44,004,745 V149A probably benign Het
Cyp4f16 C A 17: 32,545,195 probably null Het
Dlg5 G A 14: 24,158,493 Q882* probably null Het
Fsip2 T A 2: 82,992,532 I6203K probably benign Het
Gabre CCGGCT CCGGCTACGGCT X: 72,270,045 probably null Het
Gm17660 A C 5: 104,074,859 probably null Het
Gm9513 T C 9: 36,475,674 S13P possibly damaging Het
Gprc5d A T 6: 135,116,519 L130Q probably damaging Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Hmcn1 T A 1: 150,635,146 K3609* probably null Het
Hsdl2 GCTGCAG GCTGCAGCAGCAGCCACATCTGCAG 4: 59,610,652 probably benign Het
Kl A C 5: 150,953,420 Y235S probably benign Het
Map6d1 G A 16: 20,241,000 T105I probably benign Het
Mast4 GGTGGTGGTGG GGTGGTGGTGGTGGTGG 13: 102,736,307 probably benign Het
Mbd1 TGTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC TATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC 18: 74,273,573 probably benign Het
Mms22l A G 4: 24,517,207 I363V probably benign Het
Myo7a T C 7: 98,093,617 I391V probably benign Het
Nab2 A T 10: 127,664,364 D286E probably benign Het
Nrxn1 G A 17: 90,362,876 R1144C probably damaging Het
Olfr1039 T C 2: 86,131,070 M198V probably benign Het
Olfr592 T C 7: 103,186,691 I30T possibly damaging Het
Olfr635 A G 7: 103,979,561 D123G probably damaging Het
Pan2 G A 10: 128,315,535 E842K probably benign Het
Prex2 A C 1: 11,185,166 D1145A possibly damaging Het
Prp2 AGGCCCACAGCAGCGACCCCCTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC AGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC 6: 132,600,501 probably benign Het
Psip1 T C 4: 83,460,498 I353M probably damaging Het
Rapgef1 C A 2: 29,707,195 probably null Het
Rgl1 G A 1: 152,521,363 S684L probably benign Het
Sbf2 T A 7: 110,317,008 D1552V probably damaging Het
Serpinh1 C T 7: 99,346,203 V391M probably damaging Het
Slc35e4 A T 11: 3,907,960 L215Q possibly damaging Het
Tbl3 TCTT TCTTCTT 17: 24,702,541 probably benign Het
Tex15 T A 8: 33,576,677 M2045K probably benign Het
Tmprss15 T C 16: 78,953,801 *1070W probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Het
Trav15-2-dv6-2 GGAG GGAGGAG 14: 53,649,751 probably benign Het
Trav15-2-dv6-2 GAA GAACAA 14: 53,649,754 probably benign Het
Trim33 GCCCCGGCCCCCG GCCCCG 3: 103,280,212 probably null Het
Triobp GACAA GACAACCCCAGGACTCCCTGTGCCCAACGGAACAA 15: 78,967,061 probably benign Het
Tub C A 7: 109,022,639 Q95K probably benign Het
Uhrf1bp1 A T 17: 27,885,531 D517V probably damaging Het
Usp9y T A Y: 1,435,046 Q261L probably benign Het
Utp20 A T 10: 88,825,457 D29E probably damaging Het
Vill G A 9: 119,060,439 V148M probably damaging Het
Vmn2r120 C T 17: 57,521,991 E535K possibly damaging Het
Zfp451 A T 1: 33,776,792 Y692* probably null Het
Zfp599 A C 9: 22,253,884 V65G probably benign Het
Zfp808 T C 13: 62,171,299 V114A probably benign Het
Znrd1as CACCACCACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCACCACCAC 17: 36,965,048 probably benign Het
Other mutations in Prop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01676:Prop1 APN 11 50952129 missense probably damaging 1.00
IGL02192:Prop1 APN 11 50953286 splice site probably benign
IGL02219:Prop1 APN 11 50952084 missense probably damaging 1.00
IGL02551:Prop1 APN 11 50950946 missense possibly damaging 0.83
R1642:Prop1 UTSW 11 50953325 missense possibly damaging 0.46
R4909:Prop1 UTSW 11 50952036 frame shift probably null
R4909:Prop1 UTSW 11 50952045 missense probably damaging 1.00
R5743:Prop1 UTSW 11 50951009 missense probably damaging 1.00
R5879:Prop1 UTSW 11 50953326 missense probably damaging 0.97
R6324:Prop1 UTSW 11 50952199 missense probably benign 0.03
R6721:Prop1 UTSW 11 50953386 missense probably benign 0.27
R7162:Prop1 UTSW 11 50952054 missense probably damaging 0.99
RF024:Prop1 UTSW 11 50951130 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- AGGACTTTGGCGTCTCAAGG -3'
(R):5'- GGTTATGAGACATTGCCACCC -3'

Sequencing Primer
(F):5'- CTCAAGGCTGAGGGGAAACATG -3'
(R):5'- GTTATGAGACATTGCCACCCATTCAG -3'
Posted On2019-12-04