Incidental Mutation 'RF005:Baiap2'
ID602773
Institutional Source Beutler Lab
Gene Symbol Baiap2
Ensembl Gene ENSMUSG00000025372
Gene Namebrain-specific angiogenesis inhibitor 1-associated protein 2
SynonymsIRSp53
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #RF005 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location119942763-120006782 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119996529 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 217 (E217K)
Ref Sequence ENSEMBL: ENSMUSP00000026436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026436] [ENSMUST00000075180] [ENSMUST00000103021] [ENSMUST00000106231] [ENSMUST00000106233]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026436
AA Change: E217K

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026436
Gene: ENSMUSG00000025372
AA Change: E217K

DomainStartEndE-ValueType
Pfam:IMD 17 237 6e-101 PFAM
PDB:4JS0|B 261 292 2e-13 PDB
low complexity region 321 335 N/A INTRINSIC
SH3 378 437 9.77e-11 SMART
low complexity region 459 471 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000075180
AA Change: E217K

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074674
Gene: ENSMUSG00000025372
AA Change: E217K

DomainStartEndE-ValueType
Pfam:IMD 17 237 3e-98 PFAM
PDB:4JS0|B 261 292 8e-14 PDB
low complexity region 321 335 N/A INTRINSIC
SH3 378 437 9.77e-11 SMART
low complexity region 459 471 N/A INTRINSIC
low complexity region 510 522 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103021
AA Change: E217K

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099310
Gene: ENSMUSG00000025372
AA Change: E217K

DomainStartEndE-ValueType
Pfam:IMD 17 237 2.5e-98 PFAM
PDB:4JS0|B 261 292 2e-12 PDB
SH3 338 397 9.77e-11 SMART
low complexity region 419 431 N/A INTRINSIC
low complexity region 470 482 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106231
AA Change: E217K

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101838
Gene: ENSMUSG00000025372
AA Change: E217K

DomainStartEndE-ValueType
Pfam:IMD 17 237 6.4e-98 PFAM
PDB:4JS0|B 261 292 8e-14 PDB
low complexity region 321 335 N/A INTRINSIC
SH3 378 437 9.77e-11 SMART
low complexity region 459 471 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106233
AA Change: E217K

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101840
Gene: ENSMUSG00000025372
AA Change: E217K

DomainStartEndE-ValueType
Pfam:IMD 17 237 1.6e-98 PFAM
PDB:4JS0|B 261 292 8e-14 PDB
low complexity region 321 335 N/A INTRINSIC
SH3 378 437 9.77e-11 SMART
low complexity region 459 471 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency 94% (65/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been identified as a brain-specific angiogenesis inhibitor (BAI1)-binding protein. This adaptor protein links membrane bound G-proteins to cytoplasmic effector proteins. This protein functions as an insulin receptor tyrosine kinase substrate and suggests a role for insulin in the central nervous system. It also associates with a downstream effector of Rho small G proteins, which is associated with the formation of stress fibers and cytokinesis. This protein is involved in lamellipodia and filopodia formation in motile cells and may affect neuronal growth-cone guidance. This protein has also been identified as interacting with the dentatorubral-pallidoluysian atrophy gene, which is associated with an autosomal dominant neurodegenerative disease. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous mice show enhanced NMDA receptor-mediated synaptic transmission, enhanced long-term potentiation, and impaired learning and memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,884 probably benign Het
A030005L19Rik CTGCTG CTGCTGTGGATGCTG 1: 82,913,585 probably benign Het
Abca1 G T 4: 53,049,125 T1651N probably damaging Het
Adamtsl3 A G 7: 82,612,395 T40A Het
Adgra3 A T 5: 50,013,387 probably null Het
Apcs A T 1: 172,894,242 M179K probably damaging Het
Ccdc69 A G 11: 55,060,523 L24P probably damaging Het
Cdh16 T G 8: 104,617,052 N604T probably damaging Het
Cfb C T 17: 34,858,046 V538I possibly damaging Het
Col6a3 A G 1: 90,811,262 S1022P probably benign Het
Cpeb1 A G 7: 81,361,806 L129S possibly damaging Het
Crybg1 A G 10: 44,004,745 V149A probably benign Het
Cyp4f16 C A 17: 32,545,195 probably null Het
Dlg5 G A 14: 24,158,493 Q882* probably null Het
Fsip2 T A 2: 82,992,532 I6203K probably benign Het
Gabre CCGGCT CCGGCTACGGCT X: 72,270,045 probably null Het
Gm17660 A C 5: 104,074,859 probably null Het
Gm9513 T C 9: 36,475,674 S13P possibly damaging Het
Gprc5d A T 6: 135,116,519 L130Q probably damaging Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Hmcn1 T A 1: 150,635,146 K3609* probably null Het
Hsdl2 GCTGCAG GCTGCAGCAGCAGCCACATCTGCAG 4: 59,610,652 probably benign Het
Kl A C 5: 150,953,420 Y235S probably benign Het
Map6d1 G A 16: 20,241,000 T105I probably benign Het
Mast4 GGTGGTGGTGG GGTGGTGGTGGTGGTGG 13: 102,736,307 probably benign Het
Mbd1 TGTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC TATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC 18: 74,273,573 probably benign Het
Mms22l A G 4: 24,517,207 I363V probably benign Het
Myo7a T C 7: 98,093,617 I391V probably benign Het
Nab2 A T 10: 127,664,364 D286E probably benign Het
Nrxn1 G A 17: 90,362,876 R1144C probably damaging Het
Olfr1039 T C 2: 86,131,070 M198V probably benign Het
Olfr592 T C 7: 103,186,691 I30T possibly damaging Het
Olfr635 A G 7: 103,979,561 D123G probably damaging Het
Pan2 G A 10: 128,315,535 E842K probably benign Het
Prex2 A C 1: 11,185,166 D1145A possibly damaging Het
Prop1 A C 11: 50,951,130 Y150D possibly damaging Het
Prp2 AGGCCCACAGCAGCGACCCCCTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC AGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC 6: 132,600,501 probably benign Het
Psip1 T C 4: 83,460,498 I353M probably damaging Het
Rapgef1 C A 2: 29,707,195 probably null Het
Rgl1 G A 1: 152,521,363 S684L probably benign Het
Sbf2 T A 7: 110,317,008 D1552V probably damaging Het
Serpinh1 C T 7: 99,346,203 V391M probably damaging Het
Slc35e4 A T 11: 3,907,960 L215Q possibly damaging Het
Tbl3 TCTT TCTTCTT 17: 24,702,541 probably benign Het
Tex15 T A 8: 33,576,677 M2045K probably benign Het
Tmprss15 T C 16: 78,953,801 *1070W probably null Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Het
Trav15-2-dv6-2 GGAG GGAGGAG 14: 53,649,751 probably benign Het
Trav15-2-dv6-2 GAA GAACAA 14: 53,649,754 probably benign Het
Trim33 GCCCCGGCCCCCG GCCCCG 3: 103,280,212 probably null Het
Triobp GACAA GACAACCCCAGGACTCCCTGTGCCCAACGGAACAA 15: 78,967,061 probably benign Het
Tub C A 7: 109,022,639 Q95K probably benign Het
Uhrf1bp1 A T 17: 27,885,531 D517V probably damaging Het
Usp9y T A Y: 1,435,046 Q261L probably benign Het
Utp20 A T 10: 88,825,457 D29E probably damaging Het
Vill G A 9: 119,060,439 V148M probably damaging Het
Vmn2r120 C T 17: 57,521,991 E535K possibly damaging Het
Zfp451 A T 1: 33,776,792 Y692* probably null Het
Zfp599 A C 9: 22,253,884 V65G probably benign Het
Zfp808 T C 13: 62,171,299 V114A probably benign Het
Znrd1as CACCACCACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCACCACCAC 17: 36,965,048 probably benign Het
Other mutations in Baiap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Baiap2 APN 11 119982010 missense probably benign
IGL00574:Baiap2 APN 11 120006408 missense probably damaging 0.99
IGL00960:Baiap2 APN 11 119999292 missense possibly damaging 0.78
PIT4480001:Baiap2 UTSW 11 119997087 missense probably benign
R0637:Baiap2 UTSW 11 120000579 missense probably benign 0.00
R1682:Baiap2 UTSW 11 119997540 missense probably damaging 0.98
R2138:Baiap2 UTSW 11 119957102 missense possibly damaging 0.78
R2513:Baiap2 UTSW 11 119999226 missense probably benign 0.00
R4924:Baiap2 UTSW 11 119997024 missense probably damaging 1.00
R5389:Baiap2 UTSW 11 119996670 missense probably damaging 1.00
R5576:Baiap2 UTSW 11 119996911 missense probably benign 0.05
R6235:Baiap2 UTSW 11 119981408 missense probably damaging 1.00
R6966:Baiap2 UTSW 11 120006405 nonsense probably null
R7252:Baiap2 UTSW 11 120003039 missense probably benign
R8288:Baiap2 UTSW 11 119997639 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAAGTATCCCTTTTCGAGATG -3'
(R):5'- CACAAATGGTGCCAGCTCAG -3'

Sequencing Primer
(F):5'- ATCCCTTTTCGAGATGCAAGG -3'
(R):5'- AGGGCTTGGCTCCAGGAATG -3'
Posted On2019-12-04