Incidental Mutation 'RF005:Zfp808'
ID602774
Institutional Source Beutler Lab
Gene Symbol Zfp808
Ensembl Gene ENSMUSG00000074867
Gene Namezinc finger protein 808
SynonymsGm7036
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #RF005 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location62129886-62236144 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62171299 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 114 (V114A)
Ref Sequence ENSEMBL: ENSMUSP00000097048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099449] [ENSMUST00000221772]
Predicted Effect probably benign
Transcript: ENSMUST00000099449
AA Change: V114A

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097048
Gene: ENSMUSG00000074867
AA Change: V114A

DomainStartEndE-ValueType
KRAB 4 66 2.1e-17 SMART
ZnF_C2H2 133 155 2.4e-3 SMART
ZnF_C2H2 161 183 8.34e-3 SMART
ZnF_C2H2 189 211 2.75e-3 SMART
ZnF_C2H2 217 239 1.98e-4 SMART
ZnF_C2H2 245 267 3.21e-4 SMART
ZnF_C2H2 273 295 2.43e-4 SMART
ZnF_C2H2 301 323 8.6e-5 SMART
ZnF_C2H2 329 351 4.54e-4 SMART
ZnF_C2H2 357 379 9.22e-5 SMART
ZnF_C2H2 385 407 8.22e-2 SMART
ZnF_C2H2 413 435 1.56e-2 SMART
ZnF_C2H2 441 463 5.99e-4 SMART
ZnF_C2H2 469 491 2.79e-4 SMART
ZnF_C2H2 497 519 4.54e-4 SMART
ZnF_C2H2 525 547 1.95e-3 SMART
ZnF_C2H2 553 575 4.24e-4 SMART
ZnF_C2H2 581 603 2.27e-4 SMART
ZnF_C2H2 609 631 2.27e-4 SMART
ZnF_C2H2 637 659 9.08e-4 SMART
ZnF_C2H2 665 687 1.4e-4 SMART
ZnF_C2H2 693 715 4.24e-4 SMART
ZnF_C2H2 721 743 1.26e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221772
AA Change: F94L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik AGAAAGGAAAAGGTGGCCAG AGAAAGGAAAAGGTGGCCAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,884 probably benign Het
A030005L19Rik CTGCTG CTGCTGTGGATGCTG 1: 82,913,585 probably benign Het
Abca1 G T 4: 53,049,125 T1651N probably damaging Het
Adamtsl3 A G 7: 82,612,395 T40A Het
Apcs A T 1: 172,894,242 M179K probably damaging Het
Baiap2 G A 11: 119,996,529 E217K possibly damaging Het
Cacna1f GGA GGACGA X: 7,620,059 probably benign Het
Ccdc69 A G 11: 55,060,523 L24P probably damaging Het
Cdh16 T G 8: 104,617,052 N604T probably damaging Het
Cfb C T 17: 34,858,046 V538I possibly damaging Het
Col6a3 A G 1: 90,811,262 S1022P probably benign Het
Cpeb1 A G 7: 81,361,806 L129S possibly damaging Het
Crybg1 A G 10: 44,004,745 V149A probably benign Het
Dlg5 G A 14: 24,158,493 Q882* probably null Het
Fam171b GCAGCA GCAGCATCAGCA 2: 83,812,880 probably benign Het
Fsip2 T A 2: 82,992,532 I6203K probably benign Het
Gab3 CTT CTTATT X: 74,999,985 probably null Het
Gabre CCGGCT CCGGCTACGGCT X: 72,270,045 probably null Het
Gm17660 A C 5: 104,074,859 probably null Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,748 probably benign Het
Gm9513 T C 9: 36,475,674 S13P possibly damaging Het
Gprc5d A T 6: 135,116,519 L130Q probably damaging Het
H13 G A 2: 152,669,669 E30K probably damaging Het
Hmcn1 T A 1: 150,635,146 K3609* probably null Het
Hsdl2 GCTGCAG GCTGCAGCAGCAGCCACATCTGCAG 4: 59,610,652 probably benign Het
Kl A C 5: 150,953,420 Y235S probably benign Het
Lypd8 ACCAA ACCAAGCACCAACAGTTCCCTCGCCTCCGTTACCCCCCCAA 11: 58,390,231 probably benign Het
Map6d1 G A 16: 20,241,000 T105I probably benign Het
Mast4 GGTGGTGGTGG GGTGGTGGTGGTGGTGG 13: 102,736,307 probably benign Het
Mbd1 TGTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC TATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC 18: 74,273,573 probably benign Het
Mms22l A G 4: 24,517,207 I363V probably benign Het
Morn4 GTCAGGCAGTGA GTCAGGCAGTGACTCAGGCAGTGA 19: 42,076,106 probably null Het
Myo7a T C 7: 98,093,617 I391V probably benign Het
Nab2 A T 10: 127,664,364 D286E probably benign Het
Nrxn1 G A 17: 90,362,876 R1144C probably damaging Het
Nusap1 GCAGTGAGGAGCAAGCTGAGA GCAGTGAGGAGCAAGCTGAGATACACGTTACCAGTGAGGAGCAAGCTGAGA 2: 119,627,590 probably benign Het
Nusap1 AGCTGAGA AGCTGAGATACACGTTAGCAGTGAGGAGCACGCTGAGA 2: 119,627,603 probably benign Het
Olfr1039 T C 2: 86,131,070 M198V probably benign Het
Olfr592 T C 7: 103,186,691 I30T possibly damaging Het
Olfr624 CAAA CCAAAA 7: 103,670,785 probably null Het
Olfr635 A G 7: 103,979,561 D123G probably damaging Het
Pan2 G A 10: 128,315,535 E842K probably benign Het
Prex2 A C 1: 11,185,166 D1145A possibly damaging Het
Prop1 A C 11: 50,951,130 Y150D possibly damaging Het
Prp2 AGGCCCACAGCAGCGACCCCCTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC AGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC 6: 132,600,501 probably benign Het
Psip1 T C 4: 83,460,498 I353M probably damaging Het
Rfx4 T TCTCTCTCTCTCTCTCC 10: 84,858,494 probably benign Het
Rgl1 G A 1: 152,521,363 S684L probably benign Het
Rpgrip1 GGA GGAAGA 14: 52,149,391 probably benign Het
Sbf2 T A 7: 110,317,008 D1552V probably damaging Het
Serpinh1 C T 7: 99,346,203 V391M probably damaging Het
Slc35e4 A T 11: 3,907,960 L215Q possibly damaging Het
Tbl3 TCTT TCTTCTT 17: 24,702,541 probably benign Het
Tcof1 AGATGGGCCCTTTCCCAGAGATCCCCTT AGATGGGCCCTTTCCCAGAGATCCCCTTTGCTGCTGCGATGGGCCCTTTCCCAGAGATCCCCTT 18: 60,833,554 probably benign Het
Tex15 T A 8: 33,576,677 M2045K probably benign Het
Tfeb AGC AGCGGC 17: 47,786,105 probably benign Het
Tmprss15 T C 16: 78,953,801 *1070W probably null Het
Trappc9 CTGCTGCTGCTGCTGCTGCTGCTGCTGCTG CTGCTGCTGCTGCTGATGCTGCTGCTGCTGCTGCTGCTGCTGCTG 15: 72,801,300 probably benign Het
Trappc9 TGCTGCTGCTGCTGC TGCTGCTGCTGCTGCCGCTGCTGCTGCTGC 15: 72,801,310 probably benign Het
Trav15-2-dv6-2 GGGAG GGGAGGAG 14: 53,649,750 probably benign Het
Trav15-2-dv6-2 GGAG GGAGGAG 14: 53,649,751 probably benign Het
Trav15-2-dv6-2 GAA GAACAA 14: 53,649,754 probably benign Het
Trim33 GCCCCGGCCCCCG GCCCCG 3: 103,280,212 probably null Het
Triobp GACAA GACAACCCCAGGACTCCCTGTGCCCAACGGAACAA 15: 78,967,061 probably benign Het
Tub C A 7: 109,022,639 Q95K probably benign Het
Uhrf1bp1 A T 17: 27,885,531 D517V probably damaging Het
Usp9y T A Y: 1,435,046 Q261L probably benign Het
Utp20 A T 10: 88,825,457 D29E probably damaging Het
Vill G A 9: 119,060,439 V148M probably damaging Het
Vmn2r120 C T 17: 57,521,991 E535K possibly damaging Het
Zfp451 A T 1: 33,776,792 Y692* probably null Het
Zfp598 A ACCACG 17: 24,680,794 probably null Het
Zfp599 A C 9: 22,253,884 V65G probably benign Het
Znrd1as CACCACCACCACCACCACCAC CACCACCACCACCACCACCACAACCACCACCACCACCACCAC 17: 36,965,048 probably benign Het
Other mutations in Zfp808
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Zfp808 APN 13 62173209 missense probably damaging 0.96
IGL02517:Zfp808 APN 13 62173218 makesense probably null
IGL02809:Zfp808 APN 13 62173180 missense probably benign 0.00
IGL02882:Zfp808 APN 13 62173180 missense probably benign 0.00
IGL02941:Zfp808 APN 13 62173130 missense possibly damaging 0.82
IGL03184:Zfp808 APN 13 62169567 missense possibly damaging 0.90
LCD18:Zfp808 UTSW 13 62166651 intron probably benign
R0387:Zfp808 UTSW 13 62169478 missense probably damaging 1.00
R0472:Zfp808 UTSW 13 62172306 missense probably damaging 1.00
R0544:Zfp808 UTSW 13 62169434 splice site probably benign
R0635:Zfp808 UTSW 13 62172419 missense probably damaging 1.00
R0981:Zfp808 UTSW 13 62171673 missense possibly damaging 0.47
R1446:Zfp808 UTSW 13 62173007 missense probably damaging 1.00
R1569:Zfp808 UTSW 13 62172900 nonsense probably null
R1573:Zfp808 UTSW 13 62171497 missense possibly damaging 0.52
R1761:Zfp808 UTSW 13 62171646 missense possibly damaging 0.71
R1796:Zfp808 UTSW 13 62171856 missense probably damaging 1.00
R1993:Zfp808 UTSW 13 62172907 missense probably benign 0.10
R2656:Zfp808 UTSW 13 62172852 missense possibly damaging 0.63
R2938:Zfp808 UTSW 13 62171218 missense probably benign
R3027:Zfp808 UTSW 13 62171590 missense probably benign 0.33
R3777:Zfp808 UTSW 13 62171903 missense probably damaging 0.97
R3779:Zfp808 UTSW 13 62171903 missense probably damaging 0.97
R3801:Zfp808 UTSW 13 62172083 missense probably damaging 1.00
R3802:Zfp808 UTSW 13 62172083 missense probably damaging 1.00
R3804:Zfp808 UTSW 13 62172083 missense probably damaging 1.00
R4024:Zfp808 UTSW 13 62171730 missense possibly damaging 0.71
R4741:Zfp808 UTSW 13 62171949 missense probably damaging 1.00
R4791:Zfp808 UTSW 13 62171231 missense probably damaging 0.97
R4809:Zfp808 UTSW 13 62171292 nonsense probably null
R4907:Zfp808 UTSW 13 62171473 missense possibly damaging 0.71
R5056:Zfp808 UTSW 13 62172630 missense probably damaging 1.00
R5760:Zfp808 UTSW 13 62171926 missense probably damaging 1.00
R5869:Zfp808 UTSW 13 62171255 missense probably damaging 1.00
R6230:Zfp808 UTSW 13 62172322 missense probably benign 0.19
R6372:Zfp808 UTSW 13 62172477 missense probably damaging 1.00
R6545:Zfp808 UTSW 13 62171895 missense probably benign 0.02
R6620:Zfp808 UTSW 13 62172824 missense probably benign 0.08
R6622:Zfp808 UTSW 13 62171832 missense possibly damaging 0.90
R6813:Zfp808 UTSW 13 62173035 missense probably damaging 0.99
R6920:Zfp808 UTSW 13 62173168 missense probably benign 0.05
R7511:Zfp808 UTSW 13 62172823 missense probably benign
R7666:Zfp808 UTSW 13 62171411 missense probably benign
R7747:Zfp808 UTSW 13 62171505 missense probably benign 0.39
R7763:Zfp808 UTSW 13 62172664 missense probably benign 0.28
R7779:Zfp808 UTSW 13 62172757 missense possibly damaging 0.68
RF024:Zfp808 UTSW 13 62171299 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GGGGTAAAGCTTTCACATGTG -3'
(R):5'- CCAGTATGTACCCTTATATGTGTTTGG -3'

Sequencing Primer
(F):5'- GCCAATTCTCTTCTCAGGTGTGAAAG -3'
(R):5'- ACCCTTATATGTGTTTGGAGATGATG -3'
Posted On2019-12-04